Incidental Mutation 'R5040:Gata3'
ID393148
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene NameGATA binding protein 3
SynonymsGata-3, jal
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5040 (G1)
Quality Score204
Status Validated
Chromosome2
Chromosomal Location9857078-9890034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9858515 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 396 (L396P)
Ref Sequence ENSEMBL: ENSMUSP00000100041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976]
PDB Structure
Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102976
AA Change: L396P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: L396P

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151456
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
Abcc6 T C 7: 46,020,154 Q159R probably benign Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Ccdc154 A T 17: 25,164,592 T208S probably benign Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Hnrnpul1 G A 7: 25,742,989 T276I possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmc1 A G 19: 20,824,030 V502A possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Zfp457 C T 13: 67,292,835 A463T probably benign Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0724:Gata3 UTSW 2 9874575 missense probably benign
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1576:Gata3 UTSW 2 9863196 missense probably damaging 0.98
R1608:Gata3 UTSW 2 9874768 nonsense probably null
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6414:Gata3 UTSW 2 9858434 missense possibly damaging 0.95
R6696:Gata3 UTSW 2 9874492 nonsense probably null
R6848:Gata3 UTSW 2 9858528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCGCACACTTGGAGACTCC -3'
(R):5'- CCTGTGCTACTGTGCAAAAG -3'

Sequencing Primer
(F):5'- ACTTGGAGACTCCTCACGCATG -3'
(R):5'- AACCGGAAGATGTCTAGC -3'
Posted On2016-06-15