Incidental Mutation 'R0445:Ifitm1'
ID39319
Institutional Source Beutler Lab
Gene Symbol Ifitm1
Ensembl Gene ENSMUSG00000025491
Gene Nameinterferon induced transmembrane protein 1
Synonyms1110036C17Rik, Mil2, fragilis2
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0445 (G1)
Quality Score144
Status Validated
Chromosome7
Chromosomal Location140967221-140969825 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 140968441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026564] [ENSMUST00000106040] [ENSMUST00000106042]
Predicted Effect probably null
Transcript: ENSMUST00000026564
SMART Domains Protein: ENSMUSP00000026564
Gene: ENSMUSG00000025491

DomainStartEndE-ValueType
Pfam:Dispanin 18 101 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106040
SMART Domains Protein: ENSMUSP00000101655
Gene: ENSMUSG00000025491

DomainStartEndE-ValueType
Pfam:Dispanin 18 101 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106042
SMART Domains Protein: ENSMUSP00000101657
Gene: ENSMUSG00000025491

DomainStartEndE-ValueType
Pfam:CD225 24 101 2.9e-31 PFAM
Meta Mutation Damage Score 0.6528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibited enhanced motor coordination during inverted screen testing when compared with that of their wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Ifitm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ifitm1 APN 7 140969624 makesense probably null
IGL00931:Ifitm1 APN 7 140968256 start codon destroyed probably damaging 1.00
IGL02048:Ifitm1 APN 7 140968292 missense probably benign
IGL02822:Ifitm1 APN 7 140968278 missense possibly damaging 0.80
R0332:Ifitm1 UTSW 7 140968453 splice site probably benign
R0595:Ifitm1 UTSW 7 140968329 missense possibly damaging 0.88
R0655:Ifitm1 UTSW 7 140969536 missense probably benign 0.01
R1344:Ifitm1 UTSW 7 140968350 missense probably benign 0.02
R2092:Ifitm1 UTSW 7 140969514 missense probably damaging 1.00
R2411:Ifitm1 UTSW 7 140969798 utr 3 prime probably null
R6481:Ifitm1 UTSW 7 140969606 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGGTCACCCCACATCTCAACT -3'
(R):5'- CATCCAGCCAGGAGTGTTAATCTTCAG -3'

Sequencing Primer
(F):5'- ATCTCAACTTCTGCGACAGC -3'
(R):5'- tctaagcccaaaaagccctc -3'
Posted On2013-05-23