Incidental Mutation 'R5040:Tmc1'
ID393196
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Nametransmembrane channel-like gene family 1
Synonyms4933416G09Rik, Beethoven, Bth
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5040 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location20783458-20954202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20824030 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 502 (V502A)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039500
AA Change: V502A

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: V502A

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
Abcc6 T C 7: 46,020,154 Q159R probably benign Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Ccdc154 A T 17: 25,164,592 T208S probably benign Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Gata3 A G 2: 9,858,515 L396P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Hnrnpul1 G A 7: 25,742,989 T276I possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Zfp457 C T 13: 67,292,835 A463T probably benign Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTCTCCCTGAGCTAATAAATTTG -3'
(R):5'- AATTGCCTCTGAAACGGTGC -3'

Sequencing Primer
(F):5'- TTTGAAATTCAGAGGCAGCAAATG -3'
(R):5'- GAAACGGTGCTCTGTTATTTTCC -3'
Posted On2016-06-15