Incidental Mutation 'R5041:Yy1'
ID393226
Institutional Source Beutler Lab
Gene Symbol Yy1
Ensembl Gene ENSMUSG00000021264
Gene NameYY1 transcription factor
SynonymsNF-E1, UCRBP transcription factor, Yin Yang 1, delta transcription factor
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5041 (G1)
Quality Score113
Status Validated
Chromosome12
Chromosomal Location108792973-108820148 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCACCACCACCACCACCACCACCACCACC to TCACCACCACCACCACCACCACCACCACCACC at 108793631 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021692]
Predicted Effect probably benign
Transcript: ENSMUST00000021692
SMART Domains Protein: ENSMUSP00000021692
Gene: ENSMUSG00000021264

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 42 82 N/A INTRINSIC
low complexity region 156 204 N/A INTRINSIC
PDB:4C5I|C 205 228 8e-9 PDB
low complexity region 257 273 N/A INTRINSIC
ZnF_C2H2 296 320 1.03e-2 SMART
ZnF_C2H2 325 347 2.2e-2 SMART
ZnF_C2H2 353 377 9.08e-4 SMART
ZnF_C2H2 383 407 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die in utero shortly after implantation. Incomplete penetrance of embryonic growth retardation and exencephaly are observed in haploinsufficient mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Other mutations in Yy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Yy1 APN 12 108815537 missense probably damaging 1.00
IGL02158:Yy1 APN 12 108814599 splice site probably benign
IGL02223:Yy1 APN 12 108793540 missense unknown
IGL02412:Yy1 APN 12 108794097 splice site probably benign
IGL02718:Yy1 APN 12 108815479 missense probably damaging 1.00
R1023:Yy1 UTSW 12 108793531 missense unknown
R1341:Yy1 UTSW 12 108793519 missense unknown
R1855:Yy1 UTSW 12 108793990 small insertion probably benign
R1989:Yy1 UTSW 12 108806608 missense probably damaging 1.00
R2022:Yy1 UTSW 12 108793990 small insertion probably benign
R4566:Yy1 UTSW 12 108812963 missense probably damaging 0.98
R4717:Yy1 UTSW 12 108794046 missense possibly damaging 0.50
R5089:Yy1 UTSW 12 108793737 missense probably damaging 1.00
R5597:Yy1 UTSW 12 108815510 missense probably damaging 1.00
R5907:Yy1 UTSW 12 108806428 intron probably benign
R6876:Yy1 UTSW 12 108806592 missense probably benign 0.13
R6878:Yy1 UTSW 12 108814756 missense probably damaging 1.00
R6923:Yy1 UTSW 12 108793668 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CGAGATCGTGGAGCTGCAT -3'
(R):5'- CGTCTGCTCTATGTAGTCGTCG -3'

Sequencing Primer
(F):5'- ATCGTGGAGCTGCATGAGATC -3'
(R):5'- CTATGTAGTCGTCGTCGCCG -3'
Posted On2016-06-15