Incidental Mutation 'R5041:Atxn7'
ID 393227
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms Sca7, A430107N12Rik, ataxin-7
MMRRC Submission 042631-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5041 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 8362461-8508323 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14096317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect probably null
Transcript: ENSMUST00000022257
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223714
Predicted Effect probably null
Transcript: ENSMUST00000223880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223932
Predicted Effect probably null
Transcript: ENSMUST00000224315
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,550,711 (GRCm39) F667S probably benign Het
Akna A G 4: 63,305,381 (GRCm39) Y462H possibly damaging Het
Anxa11 G T 14: 25,875,188 (GRCm39) E278* probably null Het
Ap3s2 T C 7: 79,570,267 (GRCm39) Y20C probably benign Het
AW551984 T C 9: 39,511,894 (GRCm39) Y39C probably damaging Het
Becn1 A T 11: 101,179,662 (GRCm39) S442T probably benign Het
Bhlhe40 C T 6: 108,639,546 (GRCm39) T108I probably damaging Het
Cnst A G 1: 179,432,593 (GRCm39) D252G probably damaging Het
Cpxm1 A G 2: 130,235,990 (GRCm39) S391P probably damaging Het
Ctnna2 T A 6: 76,892,746 (GRCm39) N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 (GRCm39) Y282F probably benign Het
Ddx56 A G 11: 6,214,178 (GRCm39) V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 (GRCm39) C534W probably damaging Het
Gimap8 A G 6: 48,636,097 (GRCm39) N621D probably damaging Het
Herc1 T A 9: 66,336,327 (GRCm39) I1624N possibly damaging Het
Htr7 A C 19: 36,034,467 (GRCm39) W63G probably benign Het
Ly6g6c T A 17: 35,284,428 (GRCm39) probably null Het
Macf1 T C 4: 123,290,839 (GRCm39) probably null Het
Mfrp A G 9: 44,013,575 (GRCm39) D62G probably damaging Het
Ncam1 T C 9: 49,478,085 (GRCm39) Y173C probably damaging Het
Nwd1 T C 8: 73,431,683 (GRCm39) V1185A possibly damaging Het
Or4c113 A T 2: 88,885,265 (GRCm39) C168* probably null Het
Or51h7 T C 7: 102,591,785 (GRCm39) probably null Het
Pcf11 G A 7: 92,307,613 (GRCm39) P852S probably benign Het
Pramel25 T C 4: 143,520,260 (GRCm39) V4A probably benign Het
Ralgapa2 T C 2: 146,327,071 (GRCm39) I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,132 (GRCm39) probably benign Het
Rubcnl T C 14: 75,287,572 (GRCm39) F619L probably damaging Het
Sec24d A T 3: 123,087,880 (GRCm39) Q247L probably damaging Het
Spmap2l A G 5: 77,203,928 (GRCm39) T319A probably benign Het
Spns3 G T 11: 72,427,373 (GRCm39) Q306K possibly damaging Het
Sstr1 T C 12: 58,259,941 (GRCm39) V188A possibly damaging Het
Supt5 A T 7: 28,014,805 (GRCm39) L1024Q probably damaging Het
Tent4b CCCAACAACGCCAACAA CCCAACAA 8: 88,981,878 (GRCm39) probably benign Het
Unc13b T A 4: 43,237,836 (GRCm39) H3452Q probably benign Het
Usp28 A G 9: 48,949,073 (GRCm39) Q864R probably benign Het
Vmn2r43 T C 7: 8,247,806 (GRCm39) T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,759,557 (GRCm39) probably benign Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14,096,324 (GRCm38) splice site probably benign
IGL00782:Atxn7 APN 14 14,096,218 (GRCm38) missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14,100,105 (GRCm38) missense probably benign 0.00
IGL02828:Atxn7 APN 14 14,090,056 (GRCm38) missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14,100,734 (GRCm38) missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14,052,994 (GRCm38) missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14,100,564 (GRCm38) missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14,087,273 (GRCm38) splice site probably benign
Estes_park UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
Lumpy UTSW 14 14,089,446 (GRCm38) nonsense probably null
Oestes_park UTSW 14 14,096,268 (GRCm38) nonsense probably null
R0034:Atxn7 UTSW 14 14,100,846 (GRCm38) missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14,100,317 (GRCm38) missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14,089,465 (GRCm38) splice site probably benign
R1169:Atxn7 UTSW 14 14,095,468 (GRCm38) missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14,096,239 (GRCm38) missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14,089,419 (GRCm38) missense probably benign 0.25
R2078:Atxn7 UTSW 14 14,052,975 (GRCm38) missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14,013,268 (GRCm38) missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14,100,237 (GRCm38) missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14,100,308 (GRCm38) missense probably benign 0.00
R4230:Atxn7 UTSW 14 14,100,381 (GRCm38) missense probably benign 0.00
R4588:Atxn7 UTSW 14 14,096,268 (GRCm38) nonsense probably null
R4688:Atxn7 UTSW 14 14,089,288 (GRCm38) missense probably benign 0.00
R4935:Atxn7 UTSW 14 14,100,401 (GRCm38) missense probably benign
R5185:Atxn7 UTSW 14 14,090,063 (GRCm38) missense probably benign 0.04
R5561:Atxn7 UTSW 14 14,089,260 (GRCm38) missense probably benign 0.19
R5641:Atxn7 UTSW 14 14,013,638 (GRCm38) missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14,089,446 (GRCm38) nonsense probably null
R6549:Atxn7 UTSW 14 14,013,087 (GRCm38) missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14,099,972 (GRCm38) missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14,095,511 (GRCm38) missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14,100,878 (GRCm38) missense probably benign 0.08
R7402:Atxn7 UTSW 14 14,095,427 (GRCm38) missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14,100,467 (GRCm38) missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14,013,635 (GRCm38) missense probably benign 0.06
R8786:Atxn7 UTSW 14 14,103,316 (GRCm38) missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14,089,441 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACCTGGACCTCTGTGC -3'
(R):5'- CGGTACACATGGAGTTCTTTCAAC -3'

Sequencing Primer
(F):5'- ACCTCTGTGCTGGCAGTAGAG -3'
(R):5'- CACATGGAGTTCTTTCAACTAAACTC -3'
Posted On 2016-06-15