Incidental Mutation 'R0445:Themis'
ID39323
Institutional Source Beutler Lab
Gene Symbol Themis
Ensembl Gene ENSMUSG00000049109
Gene Namethymocyte selection associated
SynonymsTsepa, Gasp, E430004N04Rik
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0445 (G1)
Quality Score125
Status Validated
Chromosome10
Chromosomal Location28668360-28883818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28782011 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 192 (R192G)
Ref Sequence ENSEMBL: ENSMUSP00000123894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056097] [ENSMUST00000060409] [ENSMUST00000105516] [ENSMUST00000159927] [ENSMUST00000161345]
Predicted Effect probably damaging
Transcript: ENSMUST00000056097
AA Change: R345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: R345G

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060409
AA Change: R345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055315
Gene: ENSMUSG00000049109
AA Change: R345G

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9.3e-52 PFAM
Pfam:CABIT 282 532 5e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105516
AA Change: R345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101155
Gene: ENSMUSG00000049109
AA Change: R345G

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9e-52 PFAM
Pfam:CABIT 282 532 4.9e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159927
SMART Domains Protein: ENSMUSP00000123919
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161345
AA Change: R192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123894
Gene: ENSMUSG00000049109
AA Change: R192G

DomainStartEndE-ValueType
Pfam:CABIT 17 86 1.9e-9 PFAM
Pfam:CABIT 129 203 5.1e-18 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Themis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice site probably benign
IGL01729:Themis APN 10 28761591 nonsense probably null
IGL01833:Themis APN 10 28782311 nonsense probably null
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 intron probably benign
cloudies UTSW 10 28761199 nonsense probably null
currant UTSW 10 28782011 missense probably damaging 1.00
death_valley UTSW 10 28668727 missense probably damaging 1.00
Meteor UTSW 10 28781832 missense possibly damaging 0.90
six_flags UTSW 10 28781907 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense possibly damaging 0.90
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense possibly damaging 0.80
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably damaging 1.00
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2150:Themis UTSW 10 28668727 missense probably damaging 1.00
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5249:Themis UTSW 10 28761199 nonsense probably null
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R6467:Themis UTSW 10 28781766 missense possibly damaging 0.47
R6523:Themis UTSW 10 28781898 missense possibly damaging 0.65
R6727:Themis UTSW 10 28781907 missense probably damaging 1.00
R7014:Themis UTSW 10 28789707 missense probably benign
R7101:Themis UTSW 10 28761426 nonsense probably null
R7185:Themis UTSW 10 28781877 missense probably benign 0.00
R7386:Themis UTSW 10 28789747 missense probably benign 0.00
R7472:Themis UTSW 10 28761419 missense possibly damaging 0.69
R7555:Themis UTSW 10 28781702 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTCAGTTGCTGTCTACGGACGACC -3'
(R):5'- CCTGACTTGAAGTAGCCCTGCATC -3'

Sequencing Primer
(F):5'- CGGACGACCTTTTTGAAATGACC -3'
(R):5'- AGGAAGCTGTGCATCTTCAC -3'
Posted On2013-05-23