Incidental Mutation 'R5042:Hp1bp3'
ID393245
Institutional Source Beutler Lab
Gene Symbol Hp1bp3
Ensembl Gene ENSMUSG00000028759
Gene Nameheterochromatin protein 1, binding protein 3
SynonymsHp1bp74
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138216296-138244683 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 138222108 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000095447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030541] [ENSMUST00000097836] [ENSMUST00000105825] [ENSMUST00000105826] [ENSMUST00000105827] [ENSMUST00000124305] [ENSMUST00000130071] [ENSMUST00000137851] [ENSMUST00000137865] [ENSMUST00000165861]
Predicted Effect probably damaging
Transcript: ENSMUST00000030541
AA Change: M39K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030541
Gene: ENSMUSG00000028759
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097836
AA Change: M1K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095447
Gene: ENSMUSG00000028759
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 2.82e-18 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105825
AA Change: M1K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101451
Gene: ENSMUSG00000028759
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105826
AA Change: M39K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101452
Gene: ENSMUSG00000028759
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105827
AA Change: M39K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101453
Gene: ENSMUSG00000028759
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124305
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120587
Gene: ENSMUSG00000028759
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 45 82 N/A INTRINSIC
H15 106 165 2.94e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130071
AA Change: M39K

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably null
Transcript: ENSMUST00000137851
AA Change: M1K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118913
Gene: ENSMUSG00000028759
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137865
AA Change: M39K

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117216
Gene: ENSMUSG00000028759
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 59 74 N/A INTRINSIC
low complexity region 83 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154581
Predicted Effect probably damaging
Transcript: ENSMUST00000165861
AA Change: M39K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132614
Gene: ENSMUSG00000028759
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Meta Mutation Damage Score 0.46 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Hp1bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Hp1bp3 APN 4 138240629 missense possibly damaging 0.85
IGL02407:Hp1bp3 APN 4 138240672 missense probably damaging 1.00
IGL03036:Hp1bp3 APN 4 138228732 missense probably damaging 1.00
Supermicro UTSW 4 138225897 missense probably damaging 1.00
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0128:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0130:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0132:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0344:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0522:Hp1bp3 UTSW 4 138222161 missense possibly damaging 0.77
R0652:Hp1bp3 UTSW 4 138228769 missense possibly damaging 0.75
R1240:Hp1bp3 UTSW 4 138229698 missense probably damaging 1.00
R1793:Hp1bp3 UTSW 4 138230509 missense probably damaging 1.00
R1871:Hp1bp3 UTSW 4 138222186 missense probably damaging 1.00
R2018:Hp1bp3 UTSW 4 138221632 missense probably damaging 1.00
R2060:Hp1bp3 UTSW 4 138240672 missense probably damaging 1.00
R2255:Hp1bp3 UTSW 4 138225898 missense probably damaging 0.98
R3721:Hp1bp3 UTSW 4 138239608 missense probably damaging 1.00
R3930:Hp1bp3 UTSW 4 138221707 missense probably benign 0.29
R5423:Hp1bp3 UTSW 4 138225897 missense probably damaging 1.00
R5583:Hp1bp3 UTSW 4 138222115 missense probably damaging 1.00
R5597:Hp1bp3 UTSW 4 138221628 start codon destroyed possibly damaging 0.91
R6051:Hp1bp3 UTSW 4 138234304 missense possibly damaging 0.93
R6208:Hp1bp3 UTSW 4 138217170 start gained probably benign
R7077:Hp1bp3 UTSW 4 138239618 missense probably damaging 1.00
X0027:Hp1bp3 UTSW 4 138241673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCTGCTGGGTTCTTC -3'
(R):5'- ATGCAAACGCTTTAGACACTTCAC -3'

Sequencing Primer
(F):5'- CTGCTGGGTTCTTCATAGATACAGAG -3'
(R):5'- GCTTTAGACACTTCACTACAAGC -3'
Posted On2016-06-15