Incidental Mutation 'R5042:Ttll6'
ID393266
Institutional Source Beutler Lab
Gene Symbol Ttll6
Ensembl Gene ENSMUSG00000038756
Gene Nametubulin tyrosine ligase-like family, member 6
SynonymsD11Moh43e, t8130b59, 4932418K24Rik, D11Moh44e
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96133786-96165451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96154604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 549 (S549F)
Ref Sequence ENSEMBL: ENSMUSP00000127778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107680] [ENSMUST00000167258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107680
AA Change: S445F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103307
Gene: ENSMUSG00000038756
AA Change: S445F

DomainStartEndE-ValueType
Pfam:TTL 1 293 4.4e-90 PFAM
coiled coil region 376 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167258
AA Change: S549F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127778
Gene: ENSMUSG00000038756
AA Change: S549F

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
Pfam:TTL 103 397 2.9e-90 PFAM
coiled coil region 480 506 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Ttll6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ttll6 APN 11 96135540 nonsense probably null
IGL02331:Ttll6 APN 11 96135747 missense probably damaging 1.00
IGL02490:Ttll6 APN 11 96156720 missense possibly damaging 0.55
IGL02551:Ttll6 APN 11 96154700 missense probably benign 0.00
IGL02618:Ttll6 APN 11 96147562 missense probably benign 0.04
IGL02712:Ttll6 APN 11 96139775 critical splice donor site probably benign
IGL02720:Ttll6 APN 11 96152073 critical splice donor site probably null
IGL02839:Ttll6 APN 11 96158820 missense probably damaging 1.00
IGL02974:Ttll6 APN 11 96156702 missense probably benign 0.06
IGL03038:Ttll6 APN 11 96151960 missense probably damaging 1.00
IGL03216:Ttll6 APN 11 96152014 missense probably benign 0.00
IGL03271:Ttll6 APN 11 96156687 missense probably benign 0.00
LCD18:Ttll6 UTSW 11 96155258 intron probably benign
R0295:Ttll6 UTSW 11 96154714 missense probably benign 0.09
R0310:Ttll6 UTSW 11 96147556 missense probably benign 0.41
R0466:Ttll6 UTSW 11 96145591 missense probably damaging 1.00
R0533:Ttll6 UTSW 11 96154756 missense probably benign 0.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1453:Ttll6 UTSW 11 96158888 missense possibly damaging 0.82
R1555:Ttll6 UTSW 11 96145582 missense probably damaging 1.00
R1860:Ttll6 UTSW 11 96138874 nonsense probably null
R1861:Ttll6 UTSW 11 96138874 nonsense probably null
R1998:Ttll6 UTSW 11 96139775 critical splice donor site probably null
R2034:Ttll6 UTSW 11 96135526 missense probably damaging 0.99
R2126:Ttll6 UTSW 11 96147532 missense probably damaging 1.00
R3722:Ttll6 UTSW 11 96133921 missense probably benign 0.00
R4684:Ttll6 UTSW 11 96153177 missense probably benign
R4747:Ttll6 UTSW 11 96145546 missense possibly damaging 0.46
R4771:Ttll6 UTSW 11 96133829 missense possibly damaging 0.53
R4955:Ttll6 UTSW 11 96138789 missense possibly damaging 0.87
R5910:Ttll6 UTSW 11 96135589 missense possibly damaging 0.90
R5951:Ttll6 UTSW 11 96145510 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6134:Ttll6 UTSW 11 96139742 missense possibly damaging 0.69
R6263:Ttll6 UTSW 11 96156545 missense probably benign
R6325:Ttll6 UTSW 11 96135505 missense probably damaging 1.00
R6395:Ttll6 UTSW 11 96156588 missense probably benign 0.05
R6453:Ttll6 UTSW 11 96158727 missense probably benign 0.00
R6681:Ttll6 UTSW 11 96138863 missense probably damaging 1.00
X0022:Ttll6 UTSW 11 96158741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTCAGAGCTCCAGATTAG -3'
(R):5'- CATAAAGGCCGACTTGACTTCC -3'

Sequencing Primer
(F):5'- GAGCTCCAGATTAGAAAGTCTTTGG -3'
(R):5'- CATTGGGCACATGGAACTCTG -3'
Posted On2016-06-15