Incidental Mutation 'R0445:Olfr1383'
ID39327
Institutional Source Beutler Lab
Gene Symbol Olfr1383
Ensembl Gene ENSMUSG00000107417
Gene Nameolfactory receptor 1383
SynonymsMOR256-56, GA_x6K02T2QP88-5912627-5911692
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R0445 (G1)
Quality Score135
Status Validated
Chromosome11
Chromosomal Location49519648-49527199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49523957 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 78 (V78E)
Ref Sequence ENSEMBL: ENSMUSP00000145258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077143] [ENSMUST00000204706] [ENSMUST00000213152] [ENSMUST00000213707] [ENSMUST00000213899] [ENSMUST00000217564]
Predicted Effect probably damaging
Transcript: ENSMUST00000077143
AA Change: V78E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076390
Gene: ENSMUSG00000107417
AA Change: V78E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204706
AA Change: V78E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145258
Gene: ENSMUSG00000107417
AA Change: V78E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213152
Predicted Effect probably benign
Transcript: ENSMUST00000213707
Predicted Effect probably benign
Transcript: ENSMUST00000213899
Predicted Effect probably benign
Transcript: ENSMUST00000217564
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Olfr1383
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:Olfr1383 APN 11 49523744 missense possibly damaging 0.56
IGL03178:Olfr1383 APN 11 49523990 missense possibly damaging 0.90
R0089:Olfr1383 UTSW 11 49524206 missense possibly damaging 0.67
R0112:Olfr1383 UTSW 11 49524134 missense possibly damaging 0.70
R0243:Olfr1383 UTSW 11 49523912 missense probably damaging 1.00
R0646:Olfr1383 UTSW 11 49524578 missense probably damaging 1.00
R1695:Olfr1383 UTSW 11 49524335 missense probably benign 0.32
R2142:Olfr1383 UTSW 11 49523839 missense probably benign 0.00
R3898:Olfr1383 UTSW 11 49524559 missense probably damaging 0.98
R4085:Olfr1383 UTSW 11 49524128 missense probably benign 0.23
R5677:Olfr1383 UTSW 11 49523944 missense probably damaging 0.98
R6187:Olfr1383 UTSW 11 49523511 unclassified probably benign
R6272:Olfr1383 UTSW 11 49524126 missense possibly damaging 0.67
R6287:Olfr1383 UTSW 11 49524245 missense probably damaging 0.99
R6898:Olfr1383 UTSW 11 49523709 unclassified probably benign
R7007:Olfr1383 UTSW 11 49524184 missense probably benign 0.15
R7452:Olfr1383 UTSW 11 49524381 missense probably benign 0.03
X0017:Olfr1383 UTSW 11 49524002 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCAGACTGGCCTCAACTGGAAC -3'
(R):5'- AGCTTCAGGAGAACAAGCATCTCAC -3'

Sequencing Primer
(F):5'- TGGCCTCAACTGGAACATATC -3'
(R):5'- TTGTCTGAGTCAGAGAGTTCACAAG -3'
Posted On2013-05-23