Incidental Mutation 'R5043:Ugt2b1'
ID393294
Institutional Source Beutler Lab
Gene Symbol Ugt2b1
Ensembl Gene ENSMUSG00000035836
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B1
Synonyms1300012D20Rik
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86916638-86926530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 86917644 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 512 (C512S)
Ref Sequence ENSEMBL: ENSMUSP00000031183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031183
AA Change: C512S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031183
Gene: ENSMUSG00000035836
AA Change: C512S

DomainStartEndE-ValueType
Pfam:UDPGT 24 527 4.7e-260 PFAM
Pfam:Glyco_tran_28_C 343 454 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177553
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Ugt2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ugt2b1 APN 5 86925958 missense probably benign 0.05
IGL00556:Ugt2b1 APN 5 86926196 missense probably benign 0.00
IGL02591:Ugt2b1 APN 5 86917704 missense probably damaging 1.00
IGL02795:Ugt2b1 APN 5 86917701 missense probably damaging 1.00
IGL02993:Ugt2b1 APN 5 86921991 missense possibly damaging 0.86
IGL03057:Ugt2b1 APN 5 86926341 missense possibly damaging 0.59
IGL03084:Ugt2b1 APN 5 86926384 missense probably benign 0.00
PIT4531001:Ugt2b1 UTSW 5 86926483 missense probably benign 0.00
R0125:Ugt2b1 UTSW 5 86926102 missense probably benign
R0480:Ugt2b1 UTSW 5 86926456 missense probably benign 0.00
R0551:Ugt2b1 UTSW 5 86926084 missense probably benign 0.01
R0601:Ugt2b1 UTSW 5 86917680 missense possibly damaging 0.53
R0626:Ugt2b1 UTSW 5 86925861 missense probably null 0.13
R1238:Ugt2b1 UTSW 5 86926129 missense probably benign 0.00
R1623:Ugt2b1 UTSW 5 86926408 missense probably benign 0.25
R1919:Ugt2b1 UTSW 5 86926000 missense probably benign 0.00
R1930:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1931:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1955:Ugt2b1 UTSW 5 86917713 missense probably damaging 1.00
R3973:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R3976:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R4115:Ugt2b1 UTSW 5 86926414 missense probably damaging 0.99
R5018:Ugt2b1 UTSW 5 86925962 nonsense probably null
R5765:Ugt2b1 UTSW 5 86919406 missense probably benign 0.32
R5959:Ugt2b1 UTSW 5 86925954 missense probably benign 0.42
R5985:Ugt2b1 UTSW 5 86919668 missense possibly damaging 0.56
R6791:Ugt2b1 UTSW 5 86919257 missense probably damaging 1.00
R7380:Ugt2b1 UTSW 5 86917719 missense not run
R7414:Ugt2b1 UTSW 5 86925834 missense probably damaging 0.97
X0017:Ugt2b1 UTSW 5 86926329 missense probably benign
X0027:Ugt2b1 UTSW 5 86925798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGTCCTGACCCTGTCTTG -3'
(R):5'- TCCTTTCAGCTATAAAGAGAATGCC -3'

Sequencing Primer
(F):5'- CTTGTTTCAGAGGGAAGGCACC -3'
(R):5'- TGCCATGAGATTATCCAGAATCC -3'
Posted On2016-06-15