Incidental Mutation 'R5043:Ugt2b37'
ID393295
Institutional Source Beutler Lab
Gene Symbol Ugt2b37
Ensembl Gene ENSMUSG00000057425
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms0610033E06Rik
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87240493-87254804 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 87251860 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 263 (W263*)
Ref Sequence ENSEMBL: ENSMUSP00000075255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075858]
Predicted Effect probably null
Transcript: ENSMUST00000075858
AA Change: W263*
SMART Domains Protein: ENSMUSP00000075255
Gene: ENSMUSG00000057425
AA Change: W263*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 5.5e-256 PFAM
Pfam:Glyco_tran_28_C 328 449 2.5e-9 PFAM
Meta Mutation Damage Score 0.668 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Ugt2b37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Ugt2b37 APN 5 87242481 missense possibly damaging 0.90
IGL00567:Ugt2b37 APN 5 87254074 missense probably damaging 1.00
IGL00787:Ugt2b37 APN 5 87242429 missense probably benign 0.00
IGL01560:Ugt2b37 APN 5 87251839 missense probably damaging 1.00
IGL01617:Ugt2b37 APN 5 87251879 missense probably damaging 1.00
IGL01982:Ugt2b37 APN 5 87242432 missense probably damaging 1.00
IGL02299:Ugt2b37 APN 5 87242315 missense probably benign 0.00
IGL02323:Ugt2b37 APN 5 87250564 splice site probably benign
IGL02326:Ugt2b37 APN 5 87241002 missense probably benign 0.25
IGL02516:Ugt2b37 APN 5 87240882 missense probably damaging 1.00
IGL03285:Ugt2b37 APN 5 87240875 missense probably damaging 1.00
R0076:Ugt2b37 UTSW 5 87254221 missense probably benign 0.31
R0141:Ugt2b37 UTSW 5 87240983 missense probably damaging 1.00
R0312:Ugt2b37 UTSW 5 87250665 missense probably damaging 1.00
R0359:Ugt2b37 UTSW 5 87250584 missense probably benign 0.10
R0523:Ugt2b37 UTSW 5 87251832 missense possibly damaging 0.91
R1938:Ugt2b37 UTSW 5 87240857 missense probably damaging 1.00
R1962:Ugt2b37 UTSW 5 87254334 missense probably damaging 1.00
R2496:Ugt2b37 UTSW 5 87254710 missense probably damaging 0.97
R3704:Ugt2b37 UTSW 5 87242987 missense possibly damaging 0.55
R4430:Ugt2b37 UTSW 5 87254092 missense probably benign 0.00
R4825:Ugt2b37 UTSW 5 87250639 missense possibly damaging 0.91
R5098:Ugt2b37 UTSW 5 87242953 missense probably damaging 1.00
R5174:Ugt2b37 UTSW 5 87251880 missense probably benign 0.00
R5522:Ugt2b37 UTSW 5 87240900 missense probably benign 0.14
R5879:Ugt2b37 UTSW 5 87254406 missense probably benign
R5999:Ugt2b37 UTSW 5 87254177 missense probably benign 0.25
R6374:Ugt2b37 UTSW 5 87242420 missense probably damaging 1.00
R6454:Ugt2b37 UTSW 5 87240977 missense probably damaging 1.00
R6857:Ugt2b37 UTSW 5 87240846 missense probably damaging 0.98
R6875:Ugt2b37 UTSW 5 87242429 missense probably benign 0.00
R6916:Ugt2b37 UTSW 5 87254600 missense probably benign 0.07
R7099:Ugt2b37 UTSW 5 87240989 missense probably benign 0.00
R7239:Ugt2b37 UTSW 5 87254731 missense probably benign
R7470:Ugt2b37 UTSW 5 87254112 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCACATATCTCTATCATTGGGAGA -3'
(R):5'- ACGGTTTTAAATTACAGAGGAAAGATG -3'

Sequencing Primer
(F):5'- TCTATCATTGGGAGAAAAATGTAAGG -3'
(R):5'- GCAGATTTCTGACTTCAAGGCCAG -3'
Posted On2016-06-15