Incidental Mutation 'R5043:Tecpr1'
ID393296
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationintron (38 bp from exon)
DNA Base Change (assembly) T to C at 144197854 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060747] [ENSMUST00000085701]
Predicted Effect probably benign
Transcript: ENSMUST00000060747
SMART Domains Protein: ENSMUSP00000055493
Gene: ENSMUSG00000052271

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 41 67 N/A INTRINSIC
HLH 78 130 1.61e-18 SMART
low complexity region 136 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085701
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Meta Mutation Damage Score 0.6608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACTTTGCTGTTCTGACTCGG -3'
(R):5'- TTAGAGCACTGGATAGGCCTGG -3'

Sequencing Primer
(F):5'- CTGTTCTGACTCGGTCCAGG -3'
(R):5'- CACTGGATAGGCCTGGGTCTG -3'
Posted On2016-06-15