Incidental Mutation 'R5043:1700018F24Rik'
ID393297
Institutional Source Beutler Lab
Gene Symbol 1700018F24Rik
Ensembl Gene ENSMUSG00000029620
Gene NameRIKEN cDNA 1700018F24 gene
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145042990-145045681 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 145044100 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 106 (Y106*)
Ref Sequence ENSEMBL: ENSMUSP00000031624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031624] [ENSMUST00000151196]
Predicted Effect probably null
Transcript: ENSMUST00000031624
AA Change: Y106*
SMART Domains Protein: ENSMUSP00000031624
Gene: ENSMUSG00000029620
AA Change: Y106*

DomainStartEndE-ValueType
Pfam:RasGEF_N 62 153 2.9e-10 PFAM
low complexity region 166 186 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151196
Meta Mutation Damage Score 0.6188 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in 1700018F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:1700018F24Rik APN 5 145043147 missense possibly damaging 0.83
IGL01751:1700018F24Rik APN 5 145043171 splice site probably null
IGL02928:1700018F24Rik APN 5 145043517 missense probably damaging 1.00
IGL03324:1700018F24Rik APN 5 145045451 missense probably benign 0.01
PIT4486001:1700018F24Rik UTSW 5 145044104 missense probably damaging 1.00
R0359:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0554:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0724:1700018F24Rik UTSW 5 145044763 missense probably benign 0.10
R1774:1700018F24Rik UTSW 5 145045541 missense probably damaging 0.99
R2041:1700018F24Rik UTSW 5 145045401 missense probably damaging 0.99
R4625:1700018F24Rik UTSW 5 145044883 missense possibly damaging 0.95
R5610:1700018F24Rik UTSW 5 145045346 missense possibly damaging 0.92
R5712:1700018F24Rik UTSW 5 145044753 missense probably benign 0.32
R6163:1700018F24Rik UTSW 5 145045288 nonsense probably null
R6799:1700018F24Rik UTSW 5 145044814 missense probably damaging 1.00
R7174:1700018F24Rik UTSW 5 145044817 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGGAACCAACCAAGAGCTCTG -3'
(R):5'- ATACCTCACTCCACAGTTGGG -3'

Sequencing Primer
(F):5'- CTCTGATAGGGAACAGCTAGGCTTC -3'
(R):5'- ACTCCACAGTTGGGCCTTAC -3'
Posted On2016-06-15