Incidental Mutation 'R5043:Nlrp4c'
ID393300
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6066825 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 575 (N575S)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably benign
Transcript: ENSMUST00000037728
AA Change: N575S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: N575S

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121583
AA Change: N575S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: N575S

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207267
Predicted Effect probably benign
Transcript: ENSMUST00000208360
AA Change: N575S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6066778 missense probably benign
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6073114 missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7104:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTTTACATGAATCAGAAC -3'
(R):5'- TTGAATCTGCCTGTATAAATCACC -3'

Sequencing Primer
(F):5'- GCCTGGAAACCATAAGTG -3'
(R):5'- ATCTGCCTGTATAAATCACCAATAC -3'
Posted On2016-06-15