Incidental Mutation 'R5043:Zfp609'
ID393304
Institutional Source Beutler Lab
Gene Symbol Zfp609
Ensembl Gene ENSMUSG00000040524
Gene Namezinc finger protein 609
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65692391-65827564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65700827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1257 (Y1257C)
Ref Sequence ENSEMBL: ENSMUSP00000124089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159109]
Predicted Effect probably damaging
Transcript: ENSMUST00000159109
AA Change: Y1257C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124089
Gene: ENSMUSG00000040524
AA Change: Y1257C

DomainStartEndE-ValueType
low complexity region 83 101 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 386 405 N/A INTRINSIC
ZnF_C2H2 495 520 2.14e0 SMART
low complexity region 629 638 N/A INTRINSIC
low complexity region 657 667 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 1000 1020 N/A INTRINSIC
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
low complexity region 1329 1348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159878
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Other mutations in Zfp609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Zfp609 APN 9 65702763 missense probably benign 0.18
IGL01688:Zfp609 APN 9 65704025 missense probably benign
IGL01718:Zfp609 APN 9 65702400 nonsense probably null
IGL01860:Zfp609 APN 9 65702834 missense possibly damaging 0.82
IGL02441:Zfp609 APN 9 65703329 missense possibly damaging 0.92
IGL02490:Zfp609 APN 9 65703968 missense possibly damaging 0.92
IGL02614:Zfp609 APN 9 65702790 missense probably damaging 0.96
IGL02794:Zfp609 APN 9 65704320 missense possibly damaging 0.83
IGL02959:Zfp609 APN 9 65703393 missense probably benign
IGL02967:Zfp609 APN 9 65697619 missense possibly damaging 0.83
IGL03036:Zfp609 APN 9 65702645 missense possibly damaging 0.89
IGL03182:Zfp609 APN 9 65701005 missense probably benign 0.02
H8441:Zfp609 UTSW 9 65794887 missense possibly damaging 0.82
R0304:Zfp609 UTSW 9 65701188 missense possibly damaging 0.89
R0487:Zfp609 UTSW 9 65702634 missense unknown
R0505:Zfp609 UTSW 9 65703462 missense possibly damaging 0.92
R0684:Zfp609 UTSW 9 65731201 missense probably benign 0.01
R1480:Zfp609 UTSW 9 65703311 missense possibly damaging 0.82
R1507:Zfp609 UTSW 9 65794777 missense possibly damaging 0.92
R1579:Zfp609 UTSW 9 65704472 missense possibly damaging 0.90
R1655:Zfp609 UTSW 9 65703554 missense possibly damaging 0.46
R1692:Zfp609 UTSW 9 65795311 missense probably damaging 0.98
R1701:Zfp609 UTSW 9 65731000 missense probably benign 0.05
R1735:Zfp609 UTSW 9 65703092 nonsense probably null
R1883:Zfp609 UTSW 9 65794758 missense probably benign
R1970:Zfp609 UTSW 9 65795277 missense probably damaging 0.96
R2059:Zfp609 UTSW 9 65704434 missense possibly damaging 0.83
R2302:Zfp609 UTSW 9 65794897 missense possibly damaging 0.66
R3404:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R3405:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R4514:Zfp609 UTSW 9 65703695 missense possibly damaging 0.46
R4533:Zfp609 UTSW 9 65703608 missense probably benign 0.00
R5499:Zfp609 UTSW 9 65702855 missense probably benign 0.00
R7081:Zfp609 UTSW 9 65702441 missense possibly damaging 0.46
R7514:Zfp609 UTSW 9 65706136 missense probably benign 0.05
X0028:Zfp609 UTSW 9 65697080 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTCATTTAAGGTTAGAGTGGC -3'
(R):5'- TCTGTTCCCAAGGAAGACGG -3'

Sequencing Primer
(F):5'- TAAGGTTAGAGTGGCAACTTCCC -3'
(R):5'- GTAGTGACTGCAAGCTACCC -3'
Posted On2016-06-15