Incidental Mutation 'R5123:Eml5'
ID393410
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98874512 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 281 (Y281C)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
Predicted Effect probably damaging
Transcript: ENSMUST00000065716
AA Change: Y281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y281C

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: Y281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAAATAGTTCTATTTAGCATCGTCAC -3'
(R):5'- TAGCTCAAAGTCACATGAGCACTATG -3'

Sequencing Primer
(F):5'- TCAGCAAAAGTCCTCCAGA -3'
(R):5'- ACTGCTTCAATTATATGTTGACTTCC -3'
Posted On2016-06-15