Incidental Mutation 'R5124:Itgb4'
ID393460
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Nameintegrin beta 4
SynonymsCD104
MMRRC Submission 042712-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5124 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115974709-116008412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115984157 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 447 (R447W)
Ref Sequence ENSEMBL: ENSMUSP00000127604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
Predicted Effect probably benign
Transcript: ENSMUST00000021107
AA Change: R447W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068981
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106458
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106460
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106461
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151691
Predicted Effect probably benign
Transcript: ENSMUST00000169928
AA Change: R447W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180782
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk A G 9: 59,315,278 D496G possibly damaging Het
Agbl4 A G 4: 111,656,328 M424V probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bpifa3 C T 2: 154,138,137 Q230* probably null Het
Cog4 G T 8: 110,847,193 R48L probably damaging Het
Cop1 A G 1: 159,278,112 Y33C probably damaging Het
Cyp26a1 A T 19: 37,701,217 I454L probably benign Het
Ddr1 T C 17: 35,683,597 H762R probably damaging Het
Dnajc2 A T 5: 21,763,484 S328T probably benign Het
Dppa2 G T 16: 48,311,623 V28F probably damaging Het
Dusp15 T A 2: 152,951,355 M1L possibly damaging Het
Eml5 G A 12: 98,792,042 T1875M probably damaging Het
Fam186a A G 15: 99,943,096 S1756P possibly damaging Het
Gm436 A T 4: 144,674,719 I65N probably damaging Het
Gm5431 T A 11: 48,889,039 Q630L probably benign Het
Gm9733 T A 3: 15,320,579 R88* probably null Het
H6pd A G 4: 149,982,055 S625P possibly damaging Het
Kcnj6 G T 16: 94,832,659 P180T probably damaging Het
Lpin3 T A 2: 160,897,061 M263K probably benign Het
Lrp2 A T 2: 69,501,490 D1640E probably damaging Het
Lypd2 C T 15: 74,732,498 A74T probably benign Het
Map4k1 T C 7: 28,988,832 L223P probably damaging Het
Myh7 A T 14: 54,985,742 Y715* probably null Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neb T C 2: 52,281,498 E1661G probably damaging Het
Nek8 A T 11: 78,172,939 M80K probably damaging Het
Nup188 T A 2: 30,330,935 L979Q probably damaging Het
Olfr1218 A T 2: 89,055,087 V113D probably damaging Het
P4htm T A 9: 108,581,942 S264C possibly damaging Het
Pcdha8 A G 18: 36,993,715 T417A probably benign Het
Pclo T C 5: 14,677,392 probably benign Het
Prox1 T A 1: 190,161,279 N323I possibly damaging Het
Prune2 A T 19: 17,199,910 R222S probably damaging Het
Psmd2 C A 16: 20,652,698 R100S possibly damaging Het
Qrich2 A T 11: 116,446,773 M1963K probably damaging Het
Rbm39 C T 2: 156,159,162 G324D probably damaging Het
Rhobtb1 A T 10: 69,269,901 probably null Het
Rhov G T 2: 119,271,087 P13T unknown Het
Sec14l3 A G 11: 4,075,209 D273G possibly damaging Het
Slco2a1 T A 9: 103,050,166 I86N probably damaging Het
Smg1 A T 7: 118,213,012 S19T probably benign Het
Stk32a T C 18: 43,305,017 S194P probably benign Het
Syna G A 5: 134,559,570 S175L possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem151b T C 17: 45,547,119 Y67C probably damaging Het
Tshz1 C T 18: 84,015,467 R272Q probably damaging Het
Tti1 A G 2: 158,008,195 S375P probably damaging Het
Vcan T C 13: 89,725,517 K73E probably damaging Het
Vmn1r202 C T 13: 22,501,750 V166I probably benign Het
Vmn2r10 A G 5: 109,006,420 V6A probably benign Het
Zfhx4 A G 3: 5,242,047 D111G probably damaging Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115990940 missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115990920 missense probably damaging 1.00
IGL01431:Itgb4 APN 11 116006457 splice site probably benign
IGL01750:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02188:Itgb4 APN 11 116003387 missense probably benign 0.08
IGL02262:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02338:Itgb4 APN 11 116007969 missense probably damaging 1.00
IGL02734:Itgb4 APN 11 116005966 missense probably benign
IGL02879:Itgb4 APN 11 115994352 missense probably benign 0.05
IGL02889:Itgb4 APN 11 115988905 missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115988724 missense probably damaging 1.00
IGL03054:Itgb4 UTSW 11 116000340 nonsense probably null
R0021:Itgb4 UTSW 11 115979627 missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115979124 missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115979412 missense probably damaging 1.00
R0408:Itgb4 UTSW 11 116007602 missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115979756 missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115979695 missense probably benign 0.00
R0535:Itgb4 UTSW 11 115991009 missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115979768 missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115993342 missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115998162 intron probably benign
R1381:Itgb4 UTSW 11 115994337 missense probably benign 0.00
R1451:Itgb4 UTSW 11 115990884 missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115979111 missense probably benign 0.42
R1460:Itgb4 UTSW 11 115984164 missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115984047 missense probably benign 0.01
R1484:Itgb4 UTSW 11 115999799 missense probably benign 0.01
R1593:Itgb4 UTSW 11 115980991 missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115991316 nonsense probably null
R1633:Itgb4 UTSW 11 116007760 missense probably damaging 1.00
R1642:Itgb4 UTSW 11 116007357 missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115991330 missense probably benign 0.07
R1713:Itgb4 UTSW 11 116003489 missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115988918 missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115988520 missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115983764 missense probably benign 0.31
R1902:Itgb4 UTSW 11 115980738 missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115993453 nonsense probably null
R2102:Itgb4 UTSW 11 116005735 missense probably benign 0.23
R2184:Itgb4 UTSW 11 115979624 missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115993435 missense probably damaging 1.00
R2401:Itgb4 UTSW 11 116006563 missense possibly damaging 0.67
R3743:Itgb4 UTSW 11 116003670 missense probably damaging 1.00
R3938:Itgb4 UTSW 11 116005926 missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 116006470 missense probably benign 0.03
R4280:Itgb4 UTSW 11 115990935 missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115988729 missense probably benign 0.01
R4434:Itgb4 UTSW 11 115999814 missense probably benign 0.10
R4505:Itgb4 UTSW 11 115983261 splice site silent
R4585:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4586:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4601:Itgb4 UTSW 11 116005722 missense probably damaging 1.00
R4921:Itgb4 UTSW 11 116006605 missense probably benign 0.12
R4962:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5027:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5029:Itgb4 UTSW 11 115988591 intron probably benign
R5084:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5085:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5125:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5150:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5175:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5176:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5179:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5207:Itgb4 UTSW 11 116006539 missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5264:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5334:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5337:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5344:Itgb4 UTSW 11 115989749 missense probably null 0.92
R5391:Itgb4 UTSW 11 115985068 missense probably benign 0.05
R5437:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5440:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5653:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5654:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5655:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5772:Itgb4 UTSW 11 115988432 intron probably benign
R5812:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5813:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5814:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5863:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5954:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5982:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6043:Itgb4 UTSW 11 115979386 missense probably benign 0.30
R6133:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6134:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6135:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6169:Itgb4 UTSW 11 115994276 missense probably damaging 0.98
R6172:Itgb4 UTSW 11 116000411 missense probably benign 0.23
R6255:Itgb4 UTSW 11 115998137 missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6259:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6260:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6612:Itgb4 UTSW 11 115984071 missense probably benign 0.00
R7037:Itgb4 UTSW 11 116005565 nonsense probably null
X0062:Itgb4 UTSW 11 115993452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCCCTGTCCATACACTG -3'
(R):5'- TGCTCTCTGTGACTTGGGAC -3'

Sequencing Primer
(F):5'- TGAGCGAACAGGCTAATGTC -3'
(R):5'- CCAGGGATGTGTATCCAT -3'
Posted On2016-06-15