Incidental Mutation 'R5125:Rbm39'
ID393484
Institutional Source Beutler Lab
Gene Symbol Rbm39
Ensembl Gene ENSMUSG00000027620
Gene NameRNA binding motif protein 39
SynonymsB330012G18Rik, Caper alpha, 1500012C14Rik, caper, Rnpc2, 2310040E03Rik
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156147239-156180238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156162865 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 184 (M184K)
Ref Sequence ENSEMBL: ENSMUSP00000116820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029149] [ENSMUST00000109587] [ENSMUST00000126992] [ENSMUST00000142071] [ENSMUST00000146288] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029149
AA Change: M184K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620
AA Change: M184K

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109587
AA Change: M184K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620
AA Change: M184K

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126992
AA Change: M183K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116950
Gene: ENSMUSG00000027620
AA Change: M183K

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 135 N/A INTRINSIC
RRM 153 225 2.5e-15 SMART
PDB:2JRS|A 239 273 9e-18 PDB
Blast:RRM 250 273 4e-9 BLAST
SCOP:d1l3ka1 250 273 9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138381
Predicted Effect probably damaging
Transcript: ENSMUST00000142071
AA Change: M184K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620
AA Change: M184K

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146288
SMART Domains Protein: ENSMUSP00000114824
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 27 114 N/A INTRINSIC
PDB:2CQ4|A 115 156 2e-21 PDB
Blast:RRM 132 156 1e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000146297
AA Change: M184K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620
AA Change: M184K

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148794
AA Change: M45K
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620
AA Change: M45K

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150272
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous disruption of this locus results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Rbm39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Rbm39 APN 2 156162871 missense probably damaging 1.00
IGL01473:Rbm39 APN 2 156172979 nonsense probably null
R0040:Rbm39 UTSW 2 156148179 missense possibly damaging 0.90
R1564:Rbm39 UTSW 2 156154257 missense probably benign 0.01
R2888:Rbm39 UTSW 2 156167583 missense probably benign 0.01
R4872:Rbm39 UTSW 2 156177346 missense possibly damaging 0.94
R5124:Rbm39 UTSW 2 156159162 missense probably damaging 0.99
R5843:Rbm39 UTSW 2 156162873 missense possibly damaging 0.84
R6714:Rbm39 UTSW 2 156161618 missense possibly damaging 0.82
R6820:Rbm39 UTSW 2 156179226 start codon destroyed probably null 0.66
R6970:Rbm39 UTSW 2 156167584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCACTGATTTGCCATTTGG -3'
(R):5'- GCCTCCTTCAGTGCTTTATTAAAAC -3'

Sequencing Primer
(F):5'- GTGTTAAGTGGTACAACATCCAGCTC -3'
(R):5'- CATTCTTGCAACTTTGGAGGCAGAG -3'
Posted On2016-06-15