Incidental Mutation 'R5125:Med12l'
ID393486
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 042713-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59267214 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1851 (G1851D)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040325
AA Change: G1816D

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: G1816D

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164225
AA Change: G1851D

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: G1851D

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199400
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
AA Change: G1849D

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: G1849D

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATCATCTCACGTAACTG -3'
(R):5'- AGCCTCATCTAATCTCGGAGAAG -3'

Sequencing Primer
(F):5'- GGATCATCTCACGTAACTGAATAAG -3'
(R):5'- GGTTATGAAAATGTGAATCGAGTACC -3'
Posted On2016-06-15