Incidental Mutation 'R5125:Olfr156'
ID393487
Institutional Source Beutler Lab
Gene Symbol Olfr156
Ensembl Gene ENSMUSG00000110970
Gene Nameolfactory receptor 156
SynonymsGA_x6K02T2N78B-16125144-16126100, OR37B, Olfr37b, mOR37b, MOR262-6
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43820132-43823895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43820480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 294 (I294F)
Ref Sequence ENSEMBL: ENSMUSP00000148995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000079465] [ENSMUST00000214843] [ENSMUST00000215406]
Predicted Effect probably benign
Transcript: ENSMUST00000079234
AA Change: I294F

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: I294F

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079465
AA Change: I294F

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: I294F

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214843
AA Change: I294F

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215406
AA Change: I294F

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Olfr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Olfr156 APN 4 43821289 missense possibly damaging 0.83
IGL02690:Olfr156 APN 4 43821190 missense possibly damaging 0.50
R1454:Olfr156 UTSW 4 43820639 missense probably damaging 1.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1859:Olfr156 UTSW 4 43820779 missense possibly damaging 0.91
R2146:Olfr156 UTSW 4 43821178 missense probably damaging 1.00
R3160:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3414:Olfr156 UTSW 4 43821258 missense probably benign 0.00
R3936:Olfr156 UTSW 4 43821359 start codon destroyed probably benign 0.01
R4497:Olfr156 UTSW 4 43821175 missense probably damaging 1.00
R4631:Olfr156 UTSW 4 43820563 missense probably benign 0.08
R5371:Olfr156 UTSW 4 43821058 missense probably damaging 1.00
R5698:Olfr156 UTSW 4 43821183 missense probably damaging 1.00
R5807:Olfr156 UTSW 4 43820912 missense probably benign 0.00
R5889:Olfr156 UTSW 4 43820492 missense possibly damaging 0.89
R6461:Olfr156 UTSW 4 43821355 missense probably benign
R6865:Olfr156 UTSW 4 43821346 missense probably benign 0.00
R7566:Olfr156 UTSW 4 43820711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCTTCAGGGCTAGCCATC -3'
(R):5'- TACTCTCCACCATCCTGAGG -3'

Sequencing Primer
(F):5'- CCATCAAGGCTATGCTGAATG -3'
(R):5'- TCCACCATCCTGAGGATCCC -3'
Posted On2016-06-15