Mutagenetix > Incidental Mutation

Incidental Mutation 'R5125:Grin2b'

393495

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b

MMRRC Submission

042713-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135690231-136150509 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135900297 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 195 (V195M)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: V195M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V195M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: V195M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V195M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152012
AA Change: V195M

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V195M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

Meta Mutation Damage Score

0.2914

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,606,819 (GRCm39)	A94E	possibly damaging	Het
Carmil2	G	T	8: 106,423,521 (GRCm39)	G1207V	probably damaging	Het
Cyp2c66	A	G	19: 39,159,473 (GRCm39)	Y308C	probably damaging	Het
Dcc	A	G	18: 71,589,948 (GRCm39)	F683L	probably benign	Het
Denr	A	T	5: 124,065,144 (GRCm39)	I166F	probably damaging	Het
Dhx29	T	G	13: 113,069,134 (GRCm39)	S155A	possibly damaging	Het
Dsg1b	G	A	18: 20,530,560 (GRCm39)	G405E	probably damaging	Het
Ei24	T	A	9: 36,693,742 (GRCm39)		probably benign	Het
Exo5	A	T	4: 120,778,734 (GRCm39)		probably null	Het
Gm7356	T	C	17: 14,221,576 (GRCm39)	D151G	probably damaging	Het
Grin1	T	C	2: 25,186,839 (GRCm39)		probably benign	Het
Hephl1	T	A	9: 14,997,468 (GRCm39)	K399N	probably damaging	Het
Itgb4	C	T	11: 115,874,983 (GRCm39)	R447W	probably benign	Het
Kmt2c	A	G	5: 25,489,379 (GRCm39)	V4520A	probably damaging	Het
Lair1	G	A	7: 4,013,488 (GRCm39)	T82I	possibly damaging	Het
Lmx1a	C	T	1: 167,658,256 (GRCm39)	S213L	possibly damaging	Het
Ly6g6d	A	G	17: 35,293,418 (GRCm39)	I8T	possibly damaging	Het
Mcm4	T	A	16: 15,453,167 (GRCm39)	D174V	probably benign	Het
Mcph1	T	A	8: 18,657,342 (GRCm39)	D60E	probably damaging	Het
Med12l	G	A	3: 59,174,635 (GRCm39)	G1851D	possibly damaging	Het
Or13c7b	T	A	4: 43,820,480 (GRCm39)	I294F	probably benign	Het
Or7e174	T	A	9: 20,012,488 (GRCm39)	C144*	probably null	Het
P2rx2	G	A	5: 110,490,517 (GRCm39)	T66I	possibly damaging	Het
Pcdh15	A	G	10: 74,419,912 (GRCm39)	E1197G	probably damaging	Het
Pira1	T	A	7: 3,742,396 (GRCm39)	K44*	probably null	Het
Ppwd1	A	T	13: 104,356,943 (GRCm39)	S191T	probably benign	Het
Rbm39	A	T	2: 156,004,785 (GRCm39)	M184K	probably damaging	Het
Reln	A	G	5: 22,118,239 (GRCm39)	V2935A	possibly damaging	Het
Robo4	T	C	9: 37,319,256 (GRCm39)	W535R	probably damaging	Het
Rsf1	A	G	7: 97,311,079 (GRCm39)	D603G	possibly damaging	Het
Sh3rf3	C	G	10: 58,967,012 (GRCm39)	P785A	probably benign	Het
Slc22a26	T	C	19: 7,767,540 (GRCm39)	T289A	possibly damaging	Het
Slc24a3	T	C	2: 145,360,767 (GRCm39)	V120A	possibly damaging	Het
Sost	C	T	11: 101,854,767 (GRCm39)	G181R	probably damaging	Het
Sp2	A	G	11: 96,846,664 (GRCm39)	F554L	probably benign	Het
Stim2	T	C	5: 54,267,939 (GRCm39)	S87P	probably damaging	Het
Tecta	T	C	9: 42,286,481 (GRCm39)	D725G	probably damaging	Het
Trgc4	A	G	13: 19,528,932 (GRCm39)		probably benign	Het
Ube4b	T	C	4: 149,427,449 (GRCm39)	M900V	probably damaging	Het
Ugt2b38	A	G	5: 87,559,671 (GRCm39)	M407T	probably damaging	Het
Vmn1r87	G	T	7: 12,865,792 (GRCm39)	A165E	possibly damaging	Het
Zc3h6	A	G	2: 128,856,399 (GRCm39)	H493R	possibly damaging	Het
Zfhx2	A	T	14: 55,312,232 (GRCm39)	F154Y	probably benign	Het
Zfp729a	A	G	13: 67,785,764 (GRCm39)		probably null	Het
Zfp976	A	G	7: 42,261,925 (GRCm39)		probably null	Het
Zhx1	C	G	15: 57,917,470 (GRCm39)	G259R	probably damaging	Het
Znfx1	A	T	2: 166,888,859 (GRCm39)	V783E	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,713,329 (GRCm39)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,710,568 (GRCm39)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,713,361 (GRCm39)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,021,263 (GRCm39)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,710,379 (GRCm39)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,710,738 (GRCm39)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,709,584 (GRCm39)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,713,470 (GRCm39)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,716,088 (GRCm39)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,020,906 (GRCm39)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,900,389 (GRCm39)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,756,367 (GRCm39)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,899,996 (GRCm39)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,716,130 (GRCm39)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,716,113 (GRCm39)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,757,253 (GRCm39)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0164:Grin2b	UTSW	6	135,755,646 (GRCm39)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,756,303 (GRCm39)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,710,927 (GRCm39)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,820,193 (GRCm39)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,021,044 (GRCm39)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,709,730 (GRCm39)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,021,209 (GRCm39)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,710,243 (GRCm39)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,710,894 (GRCm39)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,757,138 (GRCm39)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,755,698 (GRCm39)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,710,180 (GRCm39)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,710,427 (GRCm39)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,717,951 (GRCm39)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,709,453 (GRCm39)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,820,108 (GRCm39)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,900,269 (GRCm39)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,713,433 (GRCm39)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,755,739 (GRCm39)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,710,823 (GRCm39)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,751,870 (GRCm39)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,755,697 (GRCm39)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,710,405 (GRCm39)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,756,393 (GRCm39)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,709,439 (GRCm39)	missense	probably benign	0.03
R5146:Grin2b	UTSW	6	135,756,340 (GRCm39)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,710,916 (GRCm39)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,021,281 (GRCm39)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,709,366 (GRCm39)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,710,721 (GRCm39)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,900,395 (GRCm39)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,710,085 (GRCm39)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,717,962 (GRCm39)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,713,371 (GRCm39)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,710,942 (GRCm39)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,900,456 (GRCm39)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,749,397 (GRCm39)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,710,025 (GRCm39)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,757,277 (GRCm39)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,717,965 (GRCm39)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,710,342 (GRCm39)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,717,996 (GRCm39)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,709,549 (GRCm39)	missense	probably benign
R6647:Grin2b	UTSW	6	135,710,108 (GRCm39)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,751,826 (GRCm39)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,757,198 (GRCm39)	missense	probably benign
R7033:Grin2b	UTSW	6	135,900,036 (GRCm39)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,757,304 (GRCm39)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,710,474 (GRCm39)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,709,946 (GRCm39)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,757,249 (GRCm39)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,717,947 (GRCm39)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,749,394 (GRCm39)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,756,301 (GRCm39)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,900,362 (GRCm39)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,709,553 (GRCm39)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,755,792 (GRCm39)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,710,225 (GRCm39)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,710,486 (GRCm39)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,709,497 (GRCm39)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,900,074 (GRCm39)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,899,967 (GRCm39)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,710,914 (GRCm39)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,899,985 (GRCm39)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,021,007 (GRCm39)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,756,255 (GRCm39)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,710,399 (GRCm39)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,899,868 (GRCm39)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,021,238 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCCATGTGTAGCCGTAGCC -3'
(R):5'- AATCCCTGTGGCTATCTGTTTG -3'

Sequencing Primer
(F):5'- ATGTGTAGCCGTAGCCAGTCAG -3'
(R):5'- TTTTGACTACTCTAGGATGAGTCC -3'

Posted On

2016-06-15