Incidental Mutation 'R5125:Vmn1r87'
ID393498
Institutional Source Beutler Lab
Gene Symbol Vmn1r87
Ensembl Gene ENSMUSG00000070815
Gene Namevomeronasal 1 receptor 87
SynonymsV1rk1
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13130904-13140157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13131865 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 165 (A165E)
Ref Sequence ENSEMBL: ENSMUSP00000154184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094827] [ENSMUST00000211249] [ENSMUST00000227443] [ENSMUST00000228800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094827
AA Change: A165E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092422
Gene: ENSMUSG00000070815
AA Change: A165E

DomainStartEndE-ValueType
Pfam:TAS2R 1 285 1.2e-11 PFAM
Pfam:V1R 14 280 1.8e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211249
AA Change: A165E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227443
AA Change: A165E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228800
AA Change: A165E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Vmn1r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Vmn1r87 APN 7 13132303 missense probably damaging 1.00
IGL01577:Vmn1r87 APN 7 13131848 missense probably benign 0.00
IGL02972:Vmn1r87 APN 7 13132329 nonsense probably null
IGL03246:Vmn1r87 APN 7 13132361 utr 5 prime probably benign
PIT4142001:Vmn1r87 UTSW 7 13132185 missense probably benign 0.00
R0153:Vmn1r87 UTSW 7 13132284 missense probably damaging 1.00
R0502:Vmn1r87 UTSW 7 13131656 missense probably damaging 1.00
R0658:Vmn1r87 UTSW 7 13131829 missense probably damaging 1.00
R1589:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R1731:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R2027:Vmn1r87 UTSW 7 13131896 missense probably damaging 0.99
R2044:Vmn1r87 UTSW 7 13131821 missense probably benign 0.02
R3124:Vmn1r87 UTSW 7 13131566 missense probably damaging 1.00
R4208:Vmn1r87 UTSW 7 13132258 missense probably benign 0.37
R4731:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4732:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4733:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R5079:Vmn1r87 UTSW 7 13132326 missense probably benign 0.01
R5178:Vmn1r87 UTSW 7 13131865 missense possibly damaging 0.79
R6599:Vmn1r87 UTSW 7 13131959 nonsense probably null
R7067:Vmn1r87 UTSW 7 13131922 missense probably benign 0.02
X0028:Vmn1r87 UTSW 7 13131983 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CCAATACTGGGTTGCTCTTGG -3'
(R):5'- AAGTGGGCATGGCTTAAATCC -3'

Sequencing Primer
(F):5'- TCTTGGGTTGGTAAAGTGAATAGAAG -3'
(R):5'- GCTTAAATCCAAGCTTGAGTCATGC -3'
Posted On2016-06-15