Incidental Mutation 'R5125:Zfp976'
ID393499
Institutional Source Beutler Lab
Gene Symbol Zfp976
Ensembl Gene ENSMUSG00000074158
Gene Namezinc finger protein 976
Synonyms9830147E19Rik
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42609526-42642588 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) A to G at 42612501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098503] [ENSMUST00000187616]
Predicted Effect probably null
Transcript: ENSMUST00000098503
SMART Domains Protein: ENSMUSP00000096105
Gene: ENSMUSG00000074158

DomainStartEndE-ValueType
KRAB 4 66 1.73e-18 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 1.67e-2 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 1.38e-3 SMART
ZnF_C2H2 243 265 8.94e-3 SMART
ZnF_C2H2 271 293 2.24e-3 SMART
ZnF_C2H2 299 321 1.03e-2 SMART
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 7.9e-4 SMART
ZnF_C2H2 383 405 5.9e-3 SMART
ZnF_C2H2 411 433 2.57e-3 SMART
ZnF_C2H2 439 461 3.16e-3 SMART
ZnF_C2H2 467 489 1.26e-2 SMART
ZnF_C2H2 495 517 8.34e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 4.79e-3 SMART
ZnF_C2H2 579 601 9.73e-4 SMART
ZnF_C2H2 607 629 3.63e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107994
Predicted Effect probably null
Transcript: ENSMUST00000187616
SMART Domains Protein: ENSMUSP00000141023
Gene: ENSMUSG00000074158

DomainStartEndE-ValueType
KRAB 3 65 7.4e-21 SMART
ZnF_C2H2 130 152 3.2e-5 SMART
ZnF_C2H2 158 180 7.1e-5 SMART
ZnF_C2H2 186 208 2.4e-5 SMART
ZnF_C2H2 214 236 5.7e-6 SMART
ZnF_C2H2 242 264 3.8e-5 SMART
ZnF_C2H2 270 292 9.7e-6 SMART
ZnF_C2H2 298 320 4.2e-5 SMART
ZnF_C2H2 326 348 6.6e-6 SMART
ZnF_C2H2 354 376 3.3e-6 SMART
ZnF_C2H2 382 404 2.5e-5 SMART
ZnF_C2H2 410 432 1e-5 SMART
ZnF_C2H2 438 460 1.3e-5 SMART
ZnF_C2H2 466 488 5.2e-5 SMART
ZnF_C2H2 494 516 3.6e-5 SMART
ZnF_C2H2 522 544 1.6e-5 SMART
ZnF_C2H2 550 572 2e-5 SMART
ZnF_C2H2 578 600 4e-6 SMART
ZnF_C2H2 606 628 1.5e-5 SMART
Meta Mutation Damage Score 0.6148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Zfp976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp976 APN 7 42613685 missense unknown
IGL01102:Zfp976 APN 7 42613909 nonsense probably null
IGL01111:Zfp976 APN 7 42616287 missense probably damaging 0.99
IGL01628:Zfp976 APN 7 42612511 missense unknown
IGL02008:Zfp976 APN 7 42614232 splice site probably benign
IGL02548:Zfp976 APN 7 42612529 missense unknown
R0190:Zfp976 UTSW 7 42642524 start gained probably benign
R0685:Zfp976 UTSW 7 42613717 missense probably damaging 0.98
R1310:Zfp976 UTSW 7 42613186 missense probably damaging 1.00
R1353:Zfp976 UTSW 7 42616018 missense probably damaging 0.99
R1447:Zfp976 UTSW 7 42612599 missense possibly damaging 0.79
R1569:Zfp976 UTSW 7 42613382 missense probably damaging 1.00
R1702:Zfp976 UTSW 7 42616000 missense possibly damaging 0.86
R1829:Zfp976 UTSW 7 42616311 missense probably damaging 1.00
R1939:Zfp976 UTSW 7 42613681 missense unknown
R1978:Zfp976 UTSW 7 42613841 missense probably damaging 1.00
R1981:Zfp976 UTSW 7 42613622 missense probably damaging 0.99
R2160:Zfp976 UTSW 7 42613930 missense probably benign
R2192:Zfp976 UTSW 7 42613271 missense probably damaging 1.00
R3121:Zfp976 UTSW 7 42613514 missense probably damaging 1.00
R4210:Zfp976 UTSW 7 42616325 missense probably damaging 0.99
R4724:Zfp976 UTSW 7 42613033 missense possibly damaging 0.91
R4943:Zfp976 UTSW 7 42612422 unclassified probably benign
R5047:Zfp976 UTSW 7 42613419 nonsense probably null
R5071:Zfp976 UTSW 7 42612930 nonsense probably null
R5178:Zfp976 UTSW 7 42612501 unclassified probably null
R5305:Zfp976 UTSW 7 42613478 missense probably benign 0.00
R5777:Zfp976 UTSW 7 42614080 missense probably benign 0.00
R6153:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R6694:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R7226:Zfp976 UTSW 7 42613260 nonsense probably null
R7479:Zfp976 UTSW 7 42613179 missense probably benign 0.01
Z1088:Zfp976 UTSW 7 42612760 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATGTATTCGAAAACACCTGGGC -3'
(R):5'- CTTCGAATGCATGAAAGAACACATA -3'

Sequencing Primer
(F):5'- CCTGGGCTGTGAAAAAGCTTTATCAC -3'
(R):5'- CCAGCTATCTTCAAATGCATGAAAG -3'
Posted On2016-06-15