Incidental Mutation 'R5125:Tecta'
ID393506
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42375185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 725 (D725G)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: D725G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: D725G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: D725G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: D725G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCACTCCATCGAAGGAAG -3'
(R):5'- ACCGCCAATTGTACAGTGC -3'

Sequencing Primer
(F):5'- GGAACCTTACCTTGACTTCCAAAG -3'
(R):5'- CCAATTGTACAGTGCAGTGC -3'
Posted On2016-06-15