Incidental Mutation 'R5125:Sp2'
ID393509
Institutional Source Beutler Lab
Gene Symbol Sp2
Ensembl Gene ENSMUSG00000018678
Gene NameSp2 transcription factor
Synonyms
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96953341-96982959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96955838 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 554 (F554L)
Ref Sequence ENSEMBL: ENSMUSP00000103249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062652] [ENSMUST00000107623] [ENSMUST00000107624]
Predicted Effect probably benign
Transcript: ENSMUST00000062652
AA Change: F554L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051403
Gene: ENSMUSG00000018678
AA Change: F554L

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107623
AA Change: F554L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103249
Gene: ENSMUSG00000018678
AA Change: F554L

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107624
AA Change: F560L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103250
Gene: ENSMUSG00000018678
AA Change: F560L

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107626
AA Change: F560L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103252
Gene: ENSMUSG00000018678
AA Change: F560L

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 209 222 N/A INTRINSIC
low complexity region 287 319 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 426 437 N/A INTRINSIC
ZnF_C2H2 525 549 5.14e-3 SMART
ZnF_C2H2 555 579 8.47e-4 SMART
ZnF_C2H2 585 607 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186326
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. The protein can act as a transcriptional activator or repressor, depending on the promoter and cell type. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: No homozygous null mice survived beyond E10.5, with decrease embryo size and embryonic growth retardation starting at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Sp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00228:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00467:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00470:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00476:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00505:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00535:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL01865:Sp2 APN 11 96961042 missense probably damaging 1.00
IGL02170:Sp2 APN 11 96956210 missense probably damaging 0.99
IGL03342:Sp2 APN 11 96961762 missense probably damaging 0.99
PIT4696001:Sp2 UTSW 11 96961973 missense probably damaging 1.00
R0082:Sp2 UTSW 11 96961699 missense probably damaging 1.00
R0086:Sp2 UTSW 11 96957427 missense probably damaging 1.00
R0525:Sp2 UTSW 11 96956098 critical splice donor site probably benign
R0789:Sp2 UTSW 11 96961376 missense probably benign 0.18
R1463:Sp2 UTSW 11 96963456 critical splice acceptor site probably benign
R1941:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2049:Sp2 UTSW 11 96961365 missense probably benign 0.09
R2153:Sp2 UTSW 11 96962008 missense possibly damaging 0.92
R2230:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2232:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2237:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2238:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2247:Sp2 UTSW 11 96962018 splice site probably null
R4638:Sp2 UTSW 11 96957474 missense possibly damaging 0.89
R5016:Sp2 UTSW 11 96955832 missense probably damaging 0.96
R5099:Sp2 UTSW 11 96961349 missense probably damaging 0.99
R5178:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5828:Sp2 UTSW 11 96960985 intron probably benign
R6286:Sp2 UTSW 11 96961546 missense probably benign 0.01
R6997:Sp2 UTSW 11 96957726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGGGACTAACTTATCTGAAAATGC -3'
(R):5'- ACAAGTCTTGGCCTGACCTC -3'

Sequencing Primer
(F):5'- TGCTACACACAGCATTTGGC -3'
(R):5'- TTGGCCTGACCTCCCGTG -3'
Posted On2016-06-15