Incidental Mutation 'R5125:Dcc'
ID393523
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71456877 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 683 (F683L)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably benign
Transcript: ENSMUST00000073379
AA Change: F683L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: F683L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114943
AA Change: F683L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: F683L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTACTGAGATGATGATGCAGAGG -3'
(R):5'- CACACTTGCGCTTGGGTTAC -3'

Sequencing Primer
(F):5'- TGGATAGTGAAAGCATTACAGGGC -3'
(R):5'- TCTGACCCTGCGCAGTTG -3'
Posted On2016-06-15