Incidental Mutation 'R5125:Cyp2c66'
ID393525
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39113898-39187072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39171029 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 308 (Y308C)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
Predicted Effect probably damaging
Transcript: ENSMUST00000087234
AA Change: Y308C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: Y308C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39170961 missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39183935 critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39171029 missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39171075 splice site probably benign
IGL02567:Cyp2c66 APN 19 39186640 utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39142039 missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39183858 missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39170958 nonsense probably null
R0092:Cyp2c66 UTSW 19 39183780 splice site probably benign
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39176691 missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39186616 missense possibly damaging 0.93
R1127:Cyp2c66 UTSW 19 39163368 missense probably damaging 1.00
R1871:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R3404:Cyp2c66 UTSW 19 39163327 missense probably benign
R3429:Cyp2c66 UTSW 19 39163448 missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39142278 missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4668:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39163399 missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39163322 critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39163470 missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39163438 missense probably benign 0.00
R5178:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5588:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R6011:Cyp2c66 UTSW 19 39141936 missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39163377 missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39186500 missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39170957 missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39141904 missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39183863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTCTGTCAGGTCAAAC -3'
(R):5'- CTTCACTTCTCTGCTATGGACTAAG -3'

Sequencing Primer
(F):5'- CCAAGGTCTGTCAGGTCAAACTTATC -3'
(R):5'- ACTTCTCTGCTATGGACTAAGATATC -3'
Posted On2016-06-15