Incidental Mutation 'R0446:Pltp'
ID39356
Institutional Source Beutler Lab
Gene Symbol Pltp
Ensembl Gene ENSMUSG00000017754
Gene Namephospholipid transfer protein
SynonymsBpife, OD107
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164839518-164857711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164854400 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 97 (N97K)
Ref Sequence ENSEMBL: ENSMUSP00000119955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059954] [ENSMUST00000109316] [ENSMUST00000109317] [ENSMUST00000128110] [ENSMUST00000156255]
Predicted Effect probably damaging
Transcript: ENSMUST00000059954
AA Change: N117K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061519
Gene: ENSMUSG00000017754
AA Change: N117K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109316
AA Change: N117K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104939
Gene: ENSMUSG00000017754
AA Change: N117K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109317
SMART Domains Protein: ENSMUSP00000104940
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 191 1.77e-40 SMART
BPI2 206 408 1.35e-68 SMART
low complexity region 425 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128110
AA Change: N117K

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122760
Gene: ENSMUSG00000017754
AA Change: N117K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 147 2.54e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148912
Predicted Effect probably damaging
Transcript: ENSMUST00000156255
AA Change: N97K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119955
Gene: ENSMUSG00000017754
AA Change: N97K

DomainStartEndE-ValueType
BPI1 10 164 3.7e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower levels of circulating HDL and exhibit symptoms of dry eye syndrome such as corneal epithelial damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Pltp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02697:Pltp APN 2 164840526 missense probably benign 0.01
R0363:Pltp UTSW 2 164840136 missense probably benign 0.03
R0496:Pltp UTSW 2 164852461 unclassified probably benign
R3845:Pltp UTSW 2 164854288 missense probably benign 0.08
R6972:Pltp UTSW 2 164846592 critical splice donor site probably null
R7365:Pltp UTSW 2 164854322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGAACTGTGGGGCTCAGGAC -3'
(R):5'- GCTGCTGAACATCTCCAACGCATC -3'

Sequencing Primer
(F):5'- CCCCGAAGGCCATATTCATT -3'
(R):5'- cccattctccacttcataacttc -3'
Posted On2013-05-23