Incidental Mutation 'R5126:Wdcp'
ID393572
Institutional Source Beutler Lab
Gene Symbol Wdcp
Ensembl Gene ENSMUSG00000051721
Gene NameWD repeat and coiled coil containing
SynonymsBC068281
MMRRC Submission 042714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R5126 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4843303-4860043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4850617 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 158 (R158S)
Ref Sequence ENSEMBL: ENSMUSP00000151585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053034] [ENSMUST00000085793] [ENSMUST00000220170] [ENSMUST00000220215] [ENSMUST00000223551]
Predicted Effect probably damaging
Transcript: ENSMUST00000053034
AA Change: R158S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054102
Gene: ENSMUSG00000051721
AA Change: R158S

DomainStartEndE-ValueType
Pfam:DUF4613 2 610 1.9e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085793
AA Change: R158S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082948
Gene: ENSMUSG00000051721
AA Change: R158S

DomainStartEndE-ValueType
Pfam:DUF4613 2 643 2.4e-280 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219069
Predicted Effect possibly damaging
Transcript: ENSMUST00000220170
AA Change: R158S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000220215
AA Change: R158S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000223551
AA Change: R158S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,996,915 probably null Het
Ahdc1 T A 4: 133,063,522 F691L probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep164 A G 9: 45,787,424 probably null Het
Cltc A G 11: 86,712,669 V781A probably damaging Het
Dchs1 A G 7: 105,753,517 S3273P probably damaging Het
Dnajc16 C A 4: 141,774,509 V337L probably benign Het
E130309D02Rik G T 5: 143,307,946 P259T probably benign Het
Fstl4 T C 11: 53,186,561 V715A possibly damaging Het
Grik1 C T 16: 87,947,859 G502S probably damaging Het
Ifi213 A G 1: 173,590,015 V277A possibly damaging Het
Jph3 T C 8: 121,753,048 V155A possibly damaging Het
Katnal2 T C 18: 77,017,598 E51G probably benign Het
Kcna2 T A 3: 107,104,234 F44I probably damaging Het
Kcna6 T C 6: 126,738,732 E398G probably damaging Het
Kif15 A T 9: 122,975,758 H190L probably damaging Het
Lmbrd2 A G 15: 9,194,701 R597G possibly damaging Het
Lrtm2 T A 6: 119,317,439 M244L probably benign Het
Ly6c2 A C 15: 75,111,643 S9A possibly damaging Het
Mbd4 T A 6: 115,848,968 probably null Het
Mfsd2b A G 12: 4,866,183 I269T probably benign Het
Muc6 A T 7: 141,651,299 C218S probably damaging Het
Nlrc5 G T 8: 94,474,671 R131L possibly damaging Het
Nlrp1b A T 11: 71,181,533 C495S possibly damaging Het
Nsf C A 11: 103,882,792 E299* probably null Het
Obscn T A 11: 59,077,063 E336D probably damaging Het
Olfr112 G T 17: 37,563,828 T161K probably benign Het
Pan3 A G 5: 147,527,198 N587S probably benign Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plscr4 G A 9: 92,488,741 D254N probably damaging Het
Pnmal1 A C 7: 16,961,317 M366L probably benign Het
Pnpla7 G T 2: 24,980,044 C12F possibly damaging Het
Pqlc2 T C 4: 139,302,532 T63A probably benign Het
Ptprk G T 10: 28,575,644 probably null Het
Rgs22 A G 15: 36,040,644 V899A probably damaging Het
Ruvbl1 T A 6: 88,485,901 C336S probably benign Het
Slc27a5 T A 7: 12,991,320 H400L probably damaging Het
Slco1a4 A T 6: 141,815,582 V435D possibly damaging Het
Snx14 A T 9: 88,382,099 Y818N probably damaging Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tlr11 T C 14: 50,360,830 L91P probably damaging Het
Tmem208 T A 8: 105,334,650 F103I probably benign Het
Tmem8 T C 17: 26,121,640 I666T probably damaging Het
Vmn2r3 C T 3: 64,259,319 C797Y probably damaging Het
Vwde T A 6: 13,187,260 M743L probably benign Het
Zfp773 T C 7: 7,136,624 T9A unknown Het
Other mutations in Wdcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL00774:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL02327:Wdcp APN 12 4851115 missense possibly damaging 0.95
IGL02725:Wdcp APN 12 4851206 missense probably damaging 1.00
IGL03377:Wdcp APN 12 4850691 nonsense probably null
IGL03381:Wdcp APN 12 4851926 missense probably damaging 1.00
R0152:Wdcp UTSW 12 4851583 missense probably benign 0.06
R0317:Wdcp UTSW 12 4851583 missense probably benign 0.06
R1077:Wdcp UTSW 12 4850685 missense probably damaging 1.00
R1136:Wdcp UTSW 12 4851655 missense possibly damaging 0.78
R1571:Wdcp UTSW 12 4851924 nonsense probably null
R1653:Wdcp UTSW 12 4851815 missense probably damaging 1.00
R1848:Wdcp UTSW 12 4850245 missense possibly damaging 0.86
R4091:Wdcp UTSW 12 4855279 missense probably null 0.00
R6148:Wdcp UTSW 12 4850621 missense possibly damaging 0.74
R6529:Wdcp UTSW 12 4851143 missense probably damaging 1.00
R6800:Wdcp UTSW 12 4851358 missense probably damaging 1.00
U24488:Wdcp UTSW 12 4850405 missense probably damaging 1.00
X0026:Wdcp UTSW 12 4851077 nonsense probably null
Z1088:Wdcp UTSW 12 4850825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGCAGGCGTCTCAGAC -3'
(R):5'- AAGGCTTCAGATGCATTTAAGC -3'

Sequencing Primer
(F):5'- AGGCGTCTCAGACCTCTG -3'
(R):5'- CTACAAAGCTTATGGAGTGGAAGTTC -3'
Posted On2016-06-15