Incidental Mutation 'R0446:Orc5'
ID39361
Institutional Source Beutler Lab
Gene Symbol Orc5
Ensembl Gene ENSMUSG00000029012
Gene Nameorigin recognition complex, subunit 5
SynonymsMmORC5, mouse origin recognition complex 5, Orc5l
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location22486485-22550429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22546457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 85 (V85I)
Ref Sequence ENSEMBL: ENSMUSP00000120214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030872] [ENSMUST00000141263]
Predicted Effect probably benign
Transcript: ENSMUST00000030872
AA Change: V103I

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030872
Gene: ENSMUSG00000029012
AA Change: V103I

DomainStartEndE-ValueType
Pfam:AAA_16 7 155 2.4e-15 PFAM
Pfam:AAA_22 28 160 2.9e-9 PFAM
Pfam:ORC5_C 177 431 5.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138248
Predicted Effect probably benign
Transcript: ENSMUST00000141263
AA Change: V85I

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120214
Gene: ENSMUSG00000029012
AA Change: V85I

DomainStartEndE-ValueType
Pfam:AAA_16 3 137 2.6e-9 PFAM
Pfam:AAA_22 11 144 1.1e-9 PFAM
Pfam:ORC5_C 159 312 2.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195898
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Orc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Orc5 APN 5 22523539 missense probably damaging 0.99
IGL00488:Orc5 APN 5 22516773 missense probably damaging 0.99
IGL01915:Orc5 APN 5 22522383 unclassified probably benign
IGL02385:Orc5 APN 5 22526440 missense probably damaging 1.00
IGL02830:Orc5 APN 5 22529267 missense probably damaging 1.00
IGL03128:Orc5 APN 5 22516773 missense probably damaging 0.99
R0372:Orc5 UTSW 5 22533784 missense possibly damaging 0.91
R2060:Orc5 UTSW 5 22516703 critical splice donor site probably null
R2144:Orc5 UTSW 5 22547927 missense possibly damaging 0.94
R2375:Orc5 UTSW 5 22546552 missense probably damaging 1.00
R3875:Orc5 UTSW 5 22537566 missense probably benign 0.00
R4620:Orc5 UTSW 5 22529176 missense probably damaging 1.00
R4625:Orc5 UTSW 5 22548005 missense probably benign
R4626:Orc5 UTSW 5 22548005 missense probably benign
R4627:Orc5 UTSW 5 22548005 missense probably benign
R4629:Orc5 UTSW 5 22548005 missense probably benign
R4664:Orc5 UTSW 5 22546522 missense probably benign
R5751:Orc5 UTSW 5 22499971 splice site probably null
R5758:Orc5 UTSW 5 22529258 missense possibly damaging 0.81
R7013:Orc5 UTSW 5 22533789 missense probably benign 0.16
R7326:Orc5 UTSW 5 22523584 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTTTCGTACTTGGTCCCAACGATG -3'
(R):5'- AGCAGACACTGCACTGTGTATGTTC -3'

Sequencing Primer
(F):5'- AGTACTTGGCATATCATGGCTACC -3'
(R):5'- ACTGCACTGTGTATGTTCTGTTTAC -3'
Posted On2013-05-23