Incidental Mutation 'R5108:Aass'
ID393664
Institutional Source Beutler Lab
Gene Symbol Aass
Ensembl Gene ENSMUSG00000029695
Gene Nameaminoadipate-semialdehyde synthase
SynonymsLOR/SDH, Lorsdh
MMRRC Submission 042696-MU
Accession Numbers

NCBI RefSeq: NM_013930.4; MGI:1353573

Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23072173-23132986 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23094208 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 94 (N94Y)
Ref Sequence ENSEMBL: ENSMUSP00000115079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031707] [ENSMUST00000149864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031707
AA Change: N504Y

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031707
Gene: ENSMUSG00000029695
AA Change: N504Y

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
AlaDh_PNT_N 27 157 2.76e-22 SMART
AlaDh_PNT_C 197 399 7.94e-23 SMART
Pfam:Sacchrp_dh_NADP 483 598 2.8e-26 PFAM
Pfam:Sacchrp_dh_C 602 916 1.2e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138063
Predicted Effect probably damaging
Transcript: ENSMUST00000149864
AA Change: N94Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115079
Gene: ENSMUSG00000029695
AA Change: N94Y

DomainStartEndE-ValueType
Pfam:Saccharop_dh 73 209 8.2e-45 PFAM
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a bifunctional mitochondrial protein that catalyzes the first two steps in the lysine degradation pathway. The N-terminus contains lysine-ketoglutarate reductase activity and converts lysine to saccharopine, whereas the C-terminus contains saccharopine dehydrogenase activity and converts saccharopine to alpha-aminoadipate semialdehyde. Mutations in a human gene encoding a highly similar protein are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Anxa3 T C 5: 96,830,414 I219T possibly damaging Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Fzr1 C T 10: 81,369,450 probably benign Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mdga2 A T 12: 66,486,741 H223Q probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Smcr8 C T 11: 60,779,870 Q615* probably null Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ubr1 C T 2: 120,963,422 G94R probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Aass
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aass APN 6 23075852 missense probably benign 0.10
IGL01465:Aass APN 6 23114839 critical splice donor site probably null
IGL01617:Aass APN 6 23115150 missense possibly damaging 0.89
IGL01810:Aass APN 6 23107634 missense probably damaging 0.99
IGL02024:Aass APN 6 23113706 missense probably damaging 1.00
IGL02167:Aass APN 6 23122722 intron probably benign
IGL02339:Aass APN 6 23093966 missense probably damaging 0.99
IGL02720:Aass APN 6 23122703 intron probably benign
IGL02877:Aass APN 6 23078876 nonsense probably null
IGL02948:Aass APN 6 23094319 splice site probably benign
PIT4651001:Aass UTSW 6 23118751 missense probably benign 0.00
R0152:Aass UTSW 6 23074689 missense probably damaging 1.00
R0196:Aass UTSW 6 23109520 missense probably damaging 1.00
R0546:Aass UTSW 6 23077077 critical splice donor site probably null
R0841:Aass UTSW 6 23075811 missense probably benign
R0848:Aass UTSW 6 23114985 missense probably damaging 0.98
R0942:Aass UTSW 6 23075152 splice site probably benign
R1082:Aass UTSW 6 23093908 missense probably damaging 1.00
R1159:Aass UTSW 6 23115138 missense probably damaging 0.99
R1730:Aass UTSW 6 23121019 missense probably damaging 1.00
R1818:Aass UTSW 6 23075858 critical splice acceptor site probably null
R1906:Aass UTSW 6 23072985 missense probably benign 0.00
R2004:Aass UTSW 6 23092562 nonsense probably null
R2191:Aass UTSW 6 23078866 missense possibly damaging 0.91
R3690:Aass UTSW 6 23091329 missense probably benign 0.09
R3843:Aass UTSW 6 23092496 nonsense probably null
R3879:Aass UTSW 6 23122521 missense probably damaging 1.00
R4080:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4081:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4082:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4348:Aass UTSW 6 23113739 missense probably benign 0.03
R4622:Aass UTSW 6 23092330 missense probably damaging 1.00
R4701:Aass UTSW 6 23075856 nonsense probably null
R4823:Aass UTSW 6 23107691 missense probably benign
R5248:Aass UTSW 6 23109438 missense probably benign 0.08
R5481:Aass UTSW 6 23113476 missense probably benign 0.00
R5776:Aass UTSW 6 23107650 missense possibly damaging 0.66
R5883:Aass UTSW 6 23072994 missense probably benign 0.04
R6356:Aass UTSW 6 23093902 missense probably damaging 1.00
R6594:Aass UTSW 6 23113433 missense probably benign 0.00
R6784:Aass UTSW 6 23093896 missense probably null 1.00
R6855:Aass UTSW 6 23114845 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCTCAGCTGCTGCATTTG -3'
(R):5'- CTGTTGTGTTTGGAGATCACAC -3'

Sequencing Primer
(F):5'- GGTCATGTCAGAGCCTATTTCAAG -3'
(R):5'- TGTTTGGAGATCACACGATTTTG -3'
Posted On2016-06-15