Incidental Mutation 'R5108:Smcr8'
ID393687
Institutional Source Beutler Lab
Gene Symbol Smcr8
Ensembl Gene ENSMUSG00000049323
Gene NameSmith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms2310076G09Rik, D030073L15Rik
MMRRC Submission 042696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60777524-60788287 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 60779870 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 615 (Q615*)
Ref Sequence ENSEMBL: ENSMUSP00000099728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000056907] [ENSMUST00000102667] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably benign
Transcript: ENSMUST00000002891
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000056907
AA Change: Q615*
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: Q615*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102667
AA Change: Q615*
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: Q615*

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,094,208 N94Y probably damaging Het
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Anxa3 T C 5: 96,830,414 I219T possibly damaging Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Fzr1 C T 10: 81,369,450 probably benign Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mdga2 A T 12: 66,486,741 H223Q probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ubr1 C T 2: 120,963,422 G94R probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Smcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGCGGATAATGAGGGG -3'
(R):5'- ACTGCCCATGTAGCTAGTGG -3'

Sequencing Primer
(F):5'- ATAATGAGGGGGCCATCCATTTCC -3'
(R):5'- GTATCCGAGTAGTTATCCAGGCTC -3'
Posted On2016-06-15