Incidental Mutation 'R5108:Mdga2'
ID393691
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 042696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5108 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66486741 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 223 (H223Q)
Ref Sequence ENSEMBL: ENSMUSP00000152049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably benign
Transcript: ENSMUST00000037181
AA Change: H951Q

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: H951Q

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178724
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: H934Q
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: H934Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222167
AA Change: H882Q

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000222623
AA Change: H223Q

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222736
Predicted Effect probably benign
Transcript: ENSMUST00000222987
AA Change: H223Q

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000223141
AA Change: H875Q

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,094,208 N94Y probably damaging Het
Ak2 A G 4: 129,002,241 T104A probably damaging Het
Alox12b G T 11: 69,157,382 A46S probably benign Het
Ank1 G T 8: 23,132,555 V1662F probably benign Het
Anxa3 T C 5: 96,830,414 I219T possibly damaging Het
Arhgap40 G A 2: 158,547,679 V588M probably damaging Het
Arhgef38 T C 3: 133,137,268 T514A probably benign Het
Ascl4 C A 10: 85,928,558 A23E probably benign Het
Bcl11b T C 12: 107,965,726 T196A probably benign Het
C1ra A T 6: 124,522,922 Y689F probably damaging Het
Ccr3 A G 9: 124,028,931 N101S probably benign Het
Cep70 A T 9: 99,263,812 probably null Het
Ces1b A G 8: 93,071,913 V215A probably damaging Het
Cndp1 A T 18: 84,632,061 I169N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo2 A G 4: 148,166,029 Q275R probably damaging Het
Fbxo44 T C 4: 148,158,563 N133S probably damaging Het
Fzr1 C T 10: 81,369,450 probably benign Het
Gm4778 C T 3: 94,265,835 S50L probably damaging Het
Grn T C 11: 102,434,402 S213P probably benign Het
Ifi203 A T 1: 173,924,014 C414S probably damaging Het
Igfn1 C T 1: 135,982,441 R135H probably benign Het
Kcnk10 T C 12: 98,435,301 M358V probably benign Het
Kcnn2 A T 18: 45,592,055 Y471F probably damaging Het
Klhl20 A T 1: 161,099,250 V391E probably damaging Het
Krt2 C T 15: 101,813,286 G440D possibly damaging Het
Lpin1 A T 12: 16,573,715 Y223N probably benign Het
Luzp2 G A 7: 55,265,290 C321Y probably damaging Het
Mcm3ap T C 10: 76,502,702 V1388A probably benign Het
Mgat4e G T 1: 134,541,223 P361Q probably benign Het
Mylk3 A T 8: 85,359,092 I208N possibly damaging Het
Myom2 T A 8: 15,132,667 V1368E probably damaging Het
Mypn C T 10: 63,136,294 D656N probably damaging Het
Nat10 C A 2: 103,732,203 R596L probably damaging Het
Nek8 T C 11: 78,172,527 D137G probably damaging Het
Neurl1a A G 19: 47,257,635 K552E probably damaging Het
Npdc1 C T 2: 25,408,655 H260Y probably damaging Het
Nuggc A T 14: 65,638,680 I581F probably damaging Het
Olfr930 T A 9: 38,930,855 I228N probably damaging Het
P2rx6 T C 16: 17,562,173 Y54H probably damaging Het
Pcmtd2 A G 2: 181,844,423 E112G probably damaging Het
Pcnx4 G A 12: 72,574,081 V892I probably benign Het
Pdss1 T A 2: 22,906,883 V136E possibly damaging Het
Pias3 T C 3: 96,704,937 L561P possibly damaging Het
Pomgnt1 G A 4: 116,156,256 probably benign Het
Scn2a C T 2: 65,688,630 T400I probably damaging Het
Sec24d T A 3: 123,305,785 probably null Het
Sftpb T G 6: 72,304,656 L11R probably damaging Het
Slc22a19 A G 19: 7,711,171 I8T probably benign Het
Slc22a30 A G 19: 8,386,426 S266P probably damaging Het
Slc36a2 C A 11: 55,159,388 G465W probably damaging Het
Slc4a2 G A 5: 24,439,333 M976I probably damaging Het
Smcr8 C T 11: 60,779,870 Q615* probably null Het
Sobp T C 10: 43,160,819 E41G probably damaging Het
Spz1 A T 13: 92,575,046 C307* probably null Het
Sult1d1 C T 5: 87,563,869 probably null Het
Svs1 C T 6: 48,988,570 T504I probably damaging Het
Tas2r110 T C 6: 132,868,705 M233T probably damaging Het
Tmc3 C A 7: 83,619,948 S781R probably damaging Het
Tmem234 G T 4: 129,601,937 probably benign Het
Trpm3 A T 19: 22,904,714 Q645L probably benign Het
Ttn C A 2: 76,734,711 V28391F probably damaging Het
Txnrd3 G T 6: 89,673,034 A425S probably benign Het
Ubr1 C T 2: 120,963,422 G94R probably benign Het
Ufl1 A G 4: 25,269,026 probably null Het
Utp20 T C 10: 88,768,873 D1720G probably benign Het
Vmn1r13 T A 6: 57,209,916 M20K probably benign Het
Vmn1r61 A G 7: 5,610,520 I265T probably benign Het
Zfp120 T C 2: 150,119,942 T29A probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTACTATGCAAATACCTTGAGGG -3'
(R):5'- TGCTCATAAATGTTTGACCAAAGAG -3'

Sequencing Primer
(F):5'- CATGAAGGCATGTGTCACTATGC -3'
(R):5'- TGACCAAAGAGAAATAAACTTGAAGC -3'
Posted On2016-06-15