Incidental Mutation 'R0446:Cdipt'
ID39378
Institutional Source Beutler Lab
Gene Symbol Cdipt
Ensembl Gene ENSMUSG00000030682
Gene NameCDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
SynonymsD7Bwg0575e, 9530042F15Rik
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0446 (G1)
Quality Score193
Status Not validated
Chromosome7
Chromosomal Location126975914-126980501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126978264 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 61 (T61A)
Ref Sequence ENSEMBL: ENSMUSP00000145918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032920] [ENSMUST00000205437] [ENSMUST00000205830] [ENSMUST00000205903] [ENSMUST00000206170] [ENSMUST00000206296] [ENSMUST00000206346] [ENSMUST00000206450] [ENSMUST00000206780] [ENSMUST00000206794] [ENSMUST00000206816]
Predicted Effect probably damaging
Transcript: ENSMUST00000032920
AA Change: T61A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032920
Gene: ENSMUSG00000030682
AA Change: T61A

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 9 72 2.4e-16 PFAM
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181859
Predicted Effect probably benign
Transcript: ENSMUST00000205437
Predicted Effect probably damaging
Transcript: ENSMUST00000205830
AA Change: T33A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000205903
Predicted Effect probably damaging
Transcript: ENSMUST00000206170
AA Change: T61A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000206296
Predicted Effect probably damaging
Transcript: ENSMUST00000206346
AA Change: T61A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000206450
AA Change: T61A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206667
Predicted Effect probably benign
Transcript: ENSMUST00000206780
Predicted Effect probably damaging
Transcript: ENSMUST00000206794
AA Change: T61A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000206816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206964
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Cdipt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Cdipt APN 7 126979553 missense possibly damaging 0.84
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0578:Cdipt UTSW 7 126979530 splice site probably null
R0828:Cdipt UTSW 7 126976920 missense probably damaging 1.00
R2020:Cdipt UTSW 7 126976933 missense possibly damaging 0.69
R4669:Cdipt UTSW 7 126978406 missense possibly damaging 0.82
R4731:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4732:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4733:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R5590:Cdipt UTSW 7 126979532 splice site probably null
R5870:Cdipt UTSW 7 126978922 missense probably benign 0.28
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6084:Cdipt UTSW 7 126979601 missense probably benign 0.10
R6090:Cdipt UTSW 7 126976959 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTAATCGAGTTCCCCAGACCCAC -3'
(R):5'- CACTGTAATGCCTTCCACTCACCAG -3'

Sequencing Primer
(F):5'- GTTGAAGATAGAGTTTCCCCATTCC -3'
(R):5'- GCACCCCAAGCATCAATCAAAG -3'
Posted On2013-05-23