Incidental Mutation 'R5110:2010315B03Rik'
List |< first << previous [record 27 of 9592] next >> last >|
ID393810
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 124295357 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably null
Transcript: ENSMUST00000071300
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177714
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185949
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189915
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Meta Mutation Damage Score 0.638 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hk1 A T 10: 62,286,651 Y422N probably damaging Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4092:2010315B03Rik UTSW 9 124293273 missense probably benign 0.03
R4109:2010315B03Rik UTSW 9 124295103 missense probably benign 0.01
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R4764:2010315B03Rik UTSW 9 124293766 missense probably benign 0.01
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCAGAGTAAAATTTCCTCAGAGCC -3'
(R):5'- TCCTTCTACAAAGACTTGGCAAT -3'

Sequencing Primer
(F):5'- CAGAGCCATATTTGTATCAGCTTGC -3'
(R):5'- TACAGTATTGCCACTATCATGTTTTC -3'
Posted On2016-06-15