Incidental Mutation 'R5111:Zswim6'
ID 393872
Institutional Source Beutler Lab
Gene Symbol Zswim6
Ensembl Gene ENSMUSG00000032846
Gene Name zinc finger SWIM-type containing 6
Synonyms 2900036G02Rik
MMRRC Submission 042699-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R5111 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 107861152-108026598 bp(-) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to G at 107865170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105097
SMART Domains Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 43 71 N/A INTRINSIC
low complexity region 132 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225822
Meta Mutation Damage Score 0.1346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 83,800,646 (GRCm39) L136* probably null Het
Ankrd17 A T 5: 90,390,858 (GRCm39) S2271T possibly damaging Het
Arhgef10 A G 8: 14,982,408 (GRCm39) D179G probably benign Het
Bcan G T 3: 87,901,514 (GRCm39) S396Y probably damaging Het
Btbd3 T A 2: 138,120,829 (GRCm39) M1K probably null Het
Capns1 A G 7: 29,891,944 (GRCm39) V106A probably benign Het
Ccnjl A G 11: 43,447,544 (GRCm39) T76A probably benign Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Col6a6 C T 9: 105,586,673 (GRCm39) V1783I possibly damaging Het
Crisp3 T C 17: 40,536,695 (GRCm39) T207A possibly damaging Het
Crxos G A 7: 15,630,142 (GRCm39) probably benign Het
Csf3r T C 4: 125,923,861 (GRCm39) probably null Het
Cyp2a12 A G 7: 26,736,046 (GRCm39) Y485C possibly damaging Het
Echdc2 A T 4: 108,026,994 (GRCm39) probably benign Het
Elp3 A C 14: 65,797,685 (GRCm39) Y329D probably damaging Het
Fbxw16 T C 9: 109,265,796 (GRCm39) D341G probably benign Het
H2-Ab1 T A 17: 34,486,456 (GRCm39) S172T probably damaging Het
Hyal2 T C 9: 107,448,310 (GRCm39) V321A probably benign Het
Ighv6-3 A T 12: 114,355,394 (GRCm39) S98R probably benign Het
Kank3 A G 17: 34,037,155 (GRCm39) E153G possibly damaging Het
Klrb1c C T 6: 128,762,968 (GRCm39) R83H probably benign Het
Krtap16-1 T C 11: 99,877,378 (GRCm39) K9E possibly damaging Het
Liph G A 16: 21,802,820 (GRCm39) S83F probably damaging Het
Lnpep A G 17: 17,798,872 (GRCm39) I261T possibly damaging Het
Mdm2 A T 10: 117,527,126 (GRCm39) V273D possibly damaging Het
Mterf1a A G 5: 3,941,860 (GRCm39) S3P probably benign Het
Myt1 A G 2: 181,437,678 (GRCm39) T172A probably benign Het
Nufip2 T A 11: 77,582,669 (GRCm39) S194R probably benign Het
Nusap1 T A 2: 119,460,837 (GRCm39) L110* probably null Het
Palb2 A T 7: 121,716,528 (GRCm39) C488* probably null Het
Pcdhac1 A T 18: 37,224,558 (GRCm39) N457I probably damaging Het
Per1 A T 11: 68,991,612 (GRCm39) S49C probably damaging Het
Ppargc1b A T 18: 61,443,558 (GRCm39) I535N probably damaging Het
Rb1cc1 T C 1: 6,284,858 (GRCm39) probably benign Het
Rpap1 A T 2: 119,601,728 (GRCm39) L744Q probably damaging Het
Sdk1 A G 5: 142,113,600 (GRCm39) E1549G probably damaging Het
Tnr C T 1: 159,713,798 (GRCm39) T742I probably benign Het
Trp53bp1 A T 2: 121,041,868 (GRCm39) H1229Q probably damaging Het
Unc80 A G 1: 66,567,154 (GRCm39) H920R possibly damaging Het
Urb1 A C 16: 90,548,905 (GRCm39) S2268A probably benign Het
Usp32 A T 11: 84,968,157 (GRCm39) Y169N possibly damaging Het
Vmn2r18 A T 5: 151,485,913 (GRCm39) M527K possibly damaging Het
Vmn2r93 A T 17: 18,546,326 (GRCm39) I733F probably damaging Het
Vstm2l A G 2: 157,777,389 (GRCm39) D89G probably damaging Het
Zdhhc8 G T 16: 18,044,612 (GRCm39) Q303K probably benign Het
Zfand2a A G 5: 139,459,509 (GRCm39) V159A probably benign Het
Other mutations in Zswim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Zswim6 APN 13 107,865,101 (GRCm39) splice site noncoding transcript
IGL02367:Zswim6 APN 13 107,880,637 (GRCm39) exon noncoding transcript
IGL02622:Zswim6 APN 13 107,884,786 (GRCm39) exon noncoding transcript
IGL03000:Zswim6 APN 13 107,863,650 (GRCm39) exon noncoding transcript
IGL03000:Zswim6 APN 13 107,863,649 (GRCm39) exon noncoding transcript
R0069:Zswim6 UTSW 13 107,875,098 (GRCm39) exon noncoding transcript
R0069:Zswim6 UTSW 13 107,875,098 (GRCm39) exon noncoding transcript
R0834:Zswim6 UTSW 13 107,862,989 (GRCm39) exon noncoding transcript
R1080:Zswim6 UTSW 13 107,924,186 (GRCm39) critical splice donor site noncoding transcript
R1542:Zswim6 UTSW 13 107,863,769 (GRCm39) exon noncoding transcript
R2081:Zswim6 UTSW 13 107,909,930 (GRCm39) exon noncoding transcript
R2133:Zswim6 UTSW 13 107,880,522 (GRCm39) exon noncoding transcript
R3692:Zswim6 UTSW 13 107,863,076 (GRCm39) exon noncoding transcript
R4323:Zswim6 UTSW 13 108,025,938 (GRCm39) exon noncoding transcript
R4345:Zswim6 UTSW 13 107,863,466 (GRCm39) exon noncoding transcript
R4369:Zswim6 UTSW 13 107,863,229 (GRCm39) exon noncoding transcript
R5049:Zswim6 UTSW 13 107,863,110 (GRCm39) exon noncoding transcript
R5174:Zswim6 UTSW 13 107,863,216 (GRCm39) exon noncoding transcript
R5531:Zswim6 UTSW 13 107,906,128 (GRCm39) exon noncoding transcript
R5933:Zswim6 UTSW 13 107,880,642 (GRCm39) exon noncoding transcript
R5934:Zswim6 UTSW 13 107,880,642 (GRCm39) exon noncoding transcript
R6063:Zswim6 UTSW 13 107,865,112 (GRCm39) exon noncoding transcript
R6168:Zswim6 UTSW 13 107,924,299 (GRCm39) exon noncoding transcript
X0022:Zswim6 UTSW 13 107,866,859 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CAAGTCCCTCCATTTAAAGTAGGG -3'
(R):5'- AGGCTCTGCTGGATTCTCAG -3'

Sequencing Primer
(F):5'- CCCTCCATTTAAAGTAGGGGGCTG -3'
(R):5'- ACATGTGGCTAGTGGACCC -3'
Posted On 2016-06-15