Incidental Mutation 'R5112:Sgip1'
ID393914
Institutional Source Beutler Lab
Gene Symbol Sgip1
Ensembl Gene ENSMUSG00000028524
Gene NameSH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms3110007P09Rik
MMRRC Submission 042700-MU
Accession Numbers

Genbank: NM_144906; MGI: 1920344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location102741297-102973628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102869769 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 81 (D81N)
Ref Sequence ENSEMBL: ENSMUSP00000063712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066824] [ENSMUST00000072481] [ENSMUST00000080728] [ENSMUST00000106882] [ENSMUST00000156596] [ENSMUST00000183855]
Predicted Effect probably damaging
Transcript: ENSMUST00000066824
AA Change: D81N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063712
Gene: ENSMUSG00000028524
AA Change: D81N

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 391 658 5.9e-79 PFAM
Pfam:Adap_comp_sub 469 650 1.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000072481
AA Change: D81N
SMART Domains Protein: ENSMUSP00000072301
Gene: ENSMUSG00000028524
AA Change: D81N

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 371 638 5.5e-79 PFAM
Pfam:Adap_comp_sub 449 630 1.8e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000080728
AA Change: D82N
SMART Domains Protein: ENSMUSP00000079553
Gene: ENSMUSG00000028524
AA Change: D82N

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 538 805 9e-79 PFAM
Pfam:Adap_comp_sub 617 797 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097948
SMART Domains Protein: ENSMUSP00000095560
Gene: ENSMUSG00000028524

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106882
AA Change: D82N
SMART Domains Protein: ENSMUSP00000102495
Gene: ENSMUSG00000028524
AA Change: D82N

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 558 825 1.7e-74 PFAM
Pfam:Adap_comp_sub 657 809 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142430
Predicted Effect probably benign
Transcript: ENSMUST00000149547
SMART Domains Protein: ENSMUSP00000122556
Gene: ENSMUSG00000028524

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
low complexity region 207 224 N/A INTRINSIC
low complexity region 226 247 N/A INTRINSIC
Pfam:muHD 307 574 3.9e-75 PFAM
Pfam:Adap_comp_sub 404 558 3.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156596
AA Change: D58N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect unknown
Transcript: ENSMUST00000183855
AA Change: D82N
SMART Domains Protein: ENSMUSP00000139337
Gene: ENSMUSG00000028524
AA Change: D82N

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751] and Uezu et al., 2007 [PubMed 17626015]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Sgip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Sgip1 APN 4 102928921 splice site probably benign
IGL01348:Sgip1 APN 4 102915156 splice site probably null
IGL01446:Sgip1 APN 4 102928913 critical splice donor site probably null
IGL01937:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL01945:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL02249:Sgip1 APN 4 102911470 missense probably benign 0.40
IGL03232:Sgip1 APN 4 102915054 splice site probably benign
3-1:Sgip1 UTSW 4 102967663 missense probably damaging 1.00
PIT4378001:Sgip1 UTSW 4 102921083 missense unknown
R0309:Sgip1 UTSW 4 102915157 splice site probably benign
R0689:Sgip1 UTSW 4 102966252 missense probably damaging 1.00
R1563:Sgip1 UTSW 4 102966260 missense probably benign 0.38
R1715:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R1899:Sgip1 UTSW 4 102968337 critical splice donor site probably null
R2286:Sgip1 UTSW 4 102867647 missense possibly damaging 0.95
R2372:Sgip1 UTSW 4 102909791 critical splice donor site probably null
R3836:Sgip1 UTSW 4 102867700 splice site probably null
R4670:Sgip1 UTSW 4 102869754 missense probably damaging 1.00
R4697:Sgip1 UTSW 4 102934587 missense probably damaging 1.00
R4725:Sgip1 UTSW 4 102966222 missense probably damaging 1.00
R4892:Sgip1 UTSW 4 102966234 missense probably damaging 1.00
R5236:Sgip1 UTSW 4 102927587 critical splice donor site probably null
R5285:Sgip1 UTSW 4 102921477 unclassified probably benign
R5323:Sgip1 UTSW 4 102966280 missense probably damaging 1.00
R5384:Sgip1 UTSW 4 102934566 missense possibly damaging 0.46
R5386:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R5682:Sgip1 UTSW 4 102967650 missense possibly damaging 0.88
R6226:Sgip1 UTSW 4 102966195 missense probably damaging 1.00
R6371:Sgip1 UTSW 4 102966285 missense probably damaging 1.00
R6594:Sgip1 UTSW 4 102962479 missense probably damaging 0.98
R6656:Sgip1 UTSW 4 102905568 intron probably benign
R6800:Sgip1 UTSW 4 102921028 unclassified probably benign
R6855:Sgip1 UTSW 4 102962376 missense probably damaging 0.99
R6917:Sgip1 UTSW 4 102968191 missense probably damaging 1.00
R7340:Sgip1 UTSW 4 102921464 missense unknown
R7414:Sgip1 UTSW 4 102967624 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCTTTAAACTAAGAGGCTGG -3'
(R):5'- CCTCGGGGAGAATTATTCATCTC -3'

Sequencing Primer
(F):5'- GAAAACATTTCCTCCATCATTTTGG -3'
(R):5'- CGGGGAGAATTATTCATCTCTGAGAC -3'
Posted On2016-06-15