Incidental Mutation 'R5112:Mmp17'
ID393921
Institutional Source Beutler Lab
Gene Symbol Mmp17
Ensembl Gene ENSMUSG00000029436
Gene Namematrix metallopeptidase 17
Synonymsmembrane type-4 matrix metalloproteinase, MT4-MMP
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129584169-129611099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129602165 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 376 (H376R)
Ref Sequence ENSEMBL: ENSMUSP00000031390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031390
AA Change: H376R

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: H376R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:PG_binding_1 44 104 5e-15 PFAM
ZnMc 128 295 8.26e-47 SMART
low complexity region 308 320 N/A INTRINSIC
HX 340 384 3.17e-8 SMART
HX 389 432 2.59e-13 SMART
HX 435 481 6.39e-13 SMART
HX 483 527 1.1e-7 SMART
low complexity region 563 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177802
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Mmp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mmp17 APN 5 129606408 missense probably benign 0.00
IGL01602:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01605:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01782:Mmp17 APN 5 129602141 missense probably damaging 1.00
IGL01986:Mmp17 APN 5 129596628 missense probably damaging 1.00
IGL02096:Mmp17 APN 5 129598688 nonsense probably null
IGL02160:Mmp17 APN 5 129595569 missense possibly damaging 0.91
IGL03075:Mmp17 APN 5 129595074 missense probably damaging 1.00
P0005:Mmp17 UTSW 5 129596631 missense probably benign 0.00
R0125:Mmp17 UTSW 5 129594582 missense possibly damaging 0.88
R0553:Mmp17 UTSW 5 129598670 missense probably benign 0.30
R1521:Mmp17 UTSW 5 129595088 splice site probably null
R1938:Mmp17 UTSW 5 129602126 missense probably damaging 1.00
R2151:Mmp17 UTSW 5 129605661 missense probably benign 0.01
R4908:Mmp17 UTSW 5 129605666 nonsense probably null
R4970:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5096:Mmp17 UTSW 5 129605563 missense probably damaging 1.00
R5178:Mmp17 UTSW 5 129595058 missense probably damaging 1.00
R5304:Mmp17 UTSW 5 129594614 missense probably null 0.89
R5341:Mmp17 UTSW 5 129602129 missense possibly damaging 0.50
R6341:Mmp17 UTSW 5 129601955 missense probably damaging 0.99
R6501:Mmp17 UTSW 5 129606405 missense probably benign 0.00
R7257:Mmp17 UTSW 5 129595633 missense probably benign 0.03
R7371:Mmp17 UTSW 5 129605772 missense probably null 0.98
W0251:Mmp17 UTSW 5 129595527 missense probably benign 0.09
Y5377:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Y5380:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGATGCTGTGGCCCAG -3'
(R):5'- TACAGCTGTTCTCACCAGTCG -3'

Sequencing Primer
(F):5'- ATGCTGTGGCCCAGATTCGAG -3'
(R):5'- CTCTAGATTGGCAGGGTGC -3'
Posted On2016-06-15