Incidental Mutation 'R5112:Clcn3'
ID393936
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Namechloride channel, voltage-sensitive 3
SynonymsClc3
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R5112 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60910389-60983300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60954552 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 24 (H24Y)
Ref Sequence ENSEMBL: ENSMUSP00000105931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
Predicted Effect probably benign
Transcript: ENSMUST00000004430
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056508
AA Change: H24Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: H24Y

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110302
AA Change: H24Y

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: H24Y

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147824
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Tbx18 T A 9: 87,715,687 I265F probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 60922792 missense probably damaging 0.99
IGL01088:Clcn3 APN 8 60937347 missense probably damaging 1.00
IGL01449:Clcn3 APN 8 60934598 missense probably damaging 0.97
IGL01792:Clcn3 APN 8 60929322 missense probably damaging 1.00
IGL01845:Clcn3 APN 8 60913095 missense probably benign 0.08
IGL01984:Clcn3 APN 8 60929580 missense probably damaging 1.00
IGL02041:Clcn3 APN 8 60923153 missense probably damaging 0.99
IGL02199:Clcn3 APN 8 60933092 nonsense probably null
IGL02199:Clcn3 APN 8 60927274 missense possibly damaging 0.82
IGL02456:Clcn3 APN 8 60941357 missense probably damaging 1.00
IGL03353:Clcn3 APN 8 60922988 missense probably benign 0.37
R0003:Clcn3 UTSW 8 60927296 nonsense probably null
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0349:Clcn3 UTSW 8 60941348 missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 60934537 missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 60929203 missense probably benign 0.25
R0840:Clcn3 UTSW 8 60929154 missense probably benign 0.22
R1167:Clcn3 UTSW 8 60922788 critical splice donor site probably null
R2035:Clcn3 UTSW 8 60934598 missense probably damaging 0.97
R2193:Clcn3 UTSW 8 60929187 missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 60913123 missense probably benign 0.02
R3736:Clcn3 UTSW 8 60983652 unclassified probably benign
R4676:Clcn3 UTSW 8 60930651 intron probably benign
R4807:Clcn3 UTSW 8 60934530 missense probably damaging 1.00
R5200:Clcn3 UTSW 8 60923005 missense probably damaging 0.99
R5652:Clcn3 UTSW 8 60919353 missense possibly damaging 0.81
R5712:Clcn3 UTSW 8 60937298 critical splice donor site probably null
R5731:Clcn3 UTSW 8 60922889 missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6134:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6370:Clcn3 UTSW 8 60923024 missense probably damaging 1.00
R6371:Clcn3 UTSW 8 60937335 missense probably benign 0.06
R6394:Clcn3 UTSW 8 60941291 missense probably damaging 0.99
R6466:Clcn3 UTSW 8 60929561 missense probably damaging 1.00
R6588:Clcn3 UTSW 8 60914827 missense probably benign 0.03
R6750:Clcn3 UTSW 8 60914775 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACTGCTAATCGCCACAGAG -3'
(R):5'- TCAGCCAGTCGAACTATGCAG -3'

Sequencing Primer
(F):5'- TGCTAATCGCCACAGAGCAAAC -3'
(R):5'- GCAGTTCTAACCTCATCAAATATGGC -3'
Posted On2016-06-15