Incidental Mutation 'R5112:Tbx18'
ID393940
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene NameT-box18
Synonyms2810404D13Rik, 2810012F10Rik
MMRRC Submission 042700-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5112 (G1)
Quality Score153
Status Not validated
Chromosome9
Chromosomal Location87702800-87731260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87715687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 265 (I265F)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: I265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: I265F

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,877,465 M80K probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acsm5 A G 7: 119,537,279 K358E possibly damaging Het
Adam26a A T 8: 43,568,856 D532E probably benign Het
Adamts19 C T 18: 59,031,804 R993* probably null Het
Akr1c13 A G 13: 4,194,152 K68R possibly damaging Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Amer3 T A 1: 34,587,076 M132K possibly damaging Het
Ankrd2 A G 19: 42,039,887 D38G possibly damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Apc T A 18: 34,316,109 C1985* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Atp13a4 A T 16: 29,409,868 N950K possibly damaging Het
Bcl6 A G 16: 23,972,746 V286A probably benign Het
Brox T A 1: 183,291,977 T79S probably benign Het
C2cd3 A T 7: 100,443,485 I512F possibly damaging Het
Camta1 A G 4: 151,074,054 L542S probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Cd96 A G 16: 46,098,938 M240T probably benign Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Clcn3 G A 8: 60,954,552 H24Y probably benign Het
Col11a2 T C 17: 34,064,088 probably benign Het
Cpsf3 A T 12: 21,291,784 M50L probably benign Het
Csf3 T A 11: 98,702,923 L197Q probably damaging Het
Ctsw T A 19: 5,466,257 D196V probably damaging Het
Dcun1d3 A T 7: 119,858,027 I154K probably damaging Het
Ddr1 T C 17: 35,682,485 T877A probably benign Het
Dnah8 T A 17: 30,731,038 L1944I probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Ephb1 A G 9: 101,971,179 I640T probably damaging Het
Fat1 G A 8: 45,024,282 G2099S probably damaging Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gart A T 16: 91,634,045 D376E probably benign Het
Glyr1 G A 16: 5,018,876 Q475* probably null Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnmt C A 17: 46,726,330 R176L probably damaging Het
Gpr176 A T 2: 118,280,148 V210D possibly damaging Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Hmbox1 A G 14: 64,825,612 Y372H probably damaging Het
Ier2 G T 8: 84,662,732 A7E probably damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Insl6 G A 19: 29,321,596 Q139* probably null Het
Itga2b A T 11: 102,458,191 I729K probably damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Klhl3 G A 13: 58,018,889 S429F probably damaging Het
Lipo2 T C 19: 33,748,465 N129S probably benign Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Ly86 G T 13: 37,375,037 G71C probably damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Mical2 A G 7: 112,320,611 S443G probably damaging Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Myo7b T C 18: 31,983,587 H989R probably damaging Het
Neil2 A G 14: 63,188,460 W154R probably damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr1449 T C 19: 12,934,816 V26A probably benign Het
Olfr1537 A G 9: 39,238,421 M1T probably null Het
Pabpc6 T A 17: 9,669,611 S4C probably damaging Het
Pan2 C T 10: 128,315,595 R835* probably null Het
Parp9 G A 16: 35,964,313 V346I probably damaging Het
Pcbp4 C T 9: 106,460,718 T69M probably damaging Het
Pclo T A 5: 14,677,882 probably benign Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Plce1 G T 19: 38,651,833 V508F probably benign Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Ryr3 A T 2: 112,902,665 V612E probably damaging Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sgip1 G A 4: 102,869,769 D81N probably damaging Het
Slc12a1 A T 2: 125,218,224 I940F possibly damaging Het
Slc25a34 T A 4: 141,621,458 I232L probably benign Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a15 T A 10: 103,389,226 D58E probably benign Het
Slc6a7 T C 18: 61,007,376 S195G probably null Het
Svep1 G A 4: 58,068,610 Q3059* probably null Het
Syce1l A C 8: 113,651,642 H56P probably damaging Het
Tbc1d2 A G 4: 46,606,503 V814A probably damaging Het
Thbs2 T C 17: 14,670,590 probably null Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Unc5a T C 13: 55,003,418 probably null Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r80 T A 10: 79,194,458 V706D possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Vwa3a A T 7: 120,783,985 Y603F probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87705623 missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87705661 missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87724331 missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87713543 missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87724408 missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87707859 missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87727406 missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87730829 missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87705580 missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87729653 missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87715516 splice site probably benign
R0374:Tbx18 UTSW 9 87724355 missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87724409 missense probably benign 0.13
R2141:Tbx18 UTSW 9 87715653 missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87705736 missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87729636 missense probably benign
R4214:Tbx18 UTSW 9 87724465 missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87730769 missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87727449 missense possibly damaging 0.48
R5887:Tbx18 UTSW 9 87713513 missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87715535 nonsense probably null
R6659:Tbx18 UTSW 9 87707811 missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87727404 missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87705264 missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87707830 missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87730697 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTACACCTAAGGAGCCTAGAAAG -3'
(R):5'- CAGATGTCCTCCTAGACCATCC -3'

Sequencing Primer
(F):5'- GGGCCACTGAAAACAGTACCTG -3'
(R):5'- AGACCATCCATGCAGCTTTG -3'
Posted On2016-06-15