Incidental Mutation 'R5113:Cysrt1'
ID393996
Institutional Source Beutler Lab
Gene Symbol Cysrt1
Ensembl Gene ENSMUSG00000036731
Gene Namecysteine rich tail 1
Synonyms2310002J15Rik
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25238818-25242452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25239351 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 50 (C50S)
Ref Sequence ENSEMBL: ENSMUSP00000140416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043379] [ENSMUST00000060818] [ENSMUST00000091318] [ENSMUST00000114355] [ENSMUST00000114356] [ENSMUST00000154498] [ENSMUST00000186719] [ENSMUST00000205192]
Predicted Effect probably benign
Transcript: ENSMUST00000006638
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043379
AA Change: C50S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045363
Gene: ENSMUSG00000036731
AA Change: C50S

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060818
SMART Domains Protein: ENSMUSP00000057742
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000088868
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000145470
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114355
SMART Domains Protein: ENSMUSP00000109995
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114356
AA Change: C50S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109996
Gene: ENSMUSG00000036731
AA Change: C50S

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154498
Predicted Effect possibly damaging
Transcript: ENSMUST00000186719
AA Change: C50S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140416
Gene: ENSMUSG00000036731
AA Change: C50S

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205192
SMART Domains Protein: ENSMUSP00000145127
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Cysrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Cysrt1 APN 2 25239501 unclassified probably benign
IGL02420:Cysrt1 APN 2 25239348 missense probably benign
R1637:Cysrt1 UTSW 2 25239285 missense probably benign 0.01
R7455:Cysrt1 UTSW 2 25239410 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCCAGCATAAGTCAGTC -3'
(R):5'- GCAGACTCCTCTTAAATGGGTGTC -3'

Sequencing Primer
(F):5'- CAGCATAAGTCAGTCCCGATGG -3'
(R):5'- GTCTTCTTAGGCGACAGGC -3'
Posted On2016-06-15