Incidental Mutation 'R5113:Ccpg1os'
ID394023
Institutional Source Beutler Lab
Gene Symbol Ccpg1os
Ensembl Gene ENSMUSG00000086158
Gene Namecell cycle progression 1, opposite strand
SynonymsGm5918
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72979722-72985382 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72979893 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 111 (R111*)
Ref Sequence ENSEMBL: ENSMUSP00000139187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124565] [ENSMUST00000149692]
Predicted Effect probably null
Transcript: ENSMUST00000124565
AA Change: R111*
SMART Domains Protein: ENSMUSP00000139187
Gene: ENSMUSG00000086158
AA Change: R111*

DomainStartEndE-ValueType
Pfam:DUF4490 41 111 2.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184123
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Ccpg1os
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6010:Ccpg1os UTSW 9 72980206 splice site probably null
R6144:Ccpg1os UTSW 9 72979988 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAACGAGGTCACTGTCAC -3'
(R):5'- CCAAAGCCCAGATGATTATGTACAAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TTATGTACAAGACCAGTGCCAG -3'
Posted On2016-06-15