Incidental Mutation 'R5113:Cltc'
ID394031
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86722321 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 459 (C459S)
Ref Sequence ENSEMBL: ENSMUSP00000099475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect probably benign
Transcript: ENSMUST00000060766
AA Change: C463S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: C463S

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103186
AA Change: C459S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: C459S

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141152
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0515:Cltc UTSW 11 86709039 missense probably benign 0.25
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5072:Cltc UTSW 11 86717968 missense possibly damaging 0.86
R5126:Cltc UTSW 11 86712669 missense probably damaging 1.00
R5177:Cltc UTSW 11 86705163 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6198:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGAGAATTTTCCCCACTGAACTCAC -3'
(R):5'- TGACAAGGTCATAGGCAATACC -3'

Sequencing Primer
(F):5'- GAGGTAAACACTCAGTGC -3'
(R):5'- CGTTCTGGAGAATTATACATAGTCAC -3'
Posted On2016-06-15