Incidental Mutation 'R5113:Hecw1'
ID394037
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5113 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14346029 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 208 (S208T)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110516
AA Change: S208T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: S208T

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223317
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Maob T C X: 16,716,423 T400A probably benign Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
demoralized UTSW 13 14316818 nonsense probably null
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense not run
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCAAAGGCAATCGATCAGATGC -3'
(R):5'- TGACCAGCTTGTTGCAGATCTTTC -3'

Sequencing Primer
(F):5'- CACATCAGCTGAGGCATTTG -3'
(R):5'- GCAGATCTTTCCTGTTAACATCTCAG -3'
Posted On2016-06-15