Incidental Mutation 'R5113:Maob'
ID394048
Institutional Source Beutler Lab
Gene Symbol Maob
Ensembl Gene ENSMUSG00000040147
Gene Namemonoamine oxidase B
SynonymsMAO-B, 6330414K01Rik
MMRRC Submission 042701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5113 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location16709282-16817366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16716423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 400 (T400A)
Ref Sequence ENSEMBL: ENSMUSP00000040550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040820] [ENSMUST00000163344] [ENSMUST00000168613]
Predicted Effect probably benign
Transcript: ENSMUST00000040820
AA Change: T400A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040550
Gene: ENSMUSG00000040147
AA Change: T400A

DomainStartEndE-ValueType
Pfam:FAD_binding_2 6 45 7.9e-8 PFAM
Pfam:NAD_binding_8 9 75 4.1e-16 PFAM
Pfam:Amino_oxidase 14 451 7.6e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163344
SMART Domains Protein: ENSMUSP00000131743
Gene: ENSMUSG00000040147

DomainStartEndE-ValueType
Pfam:Thi4 2 46 5.9e-8 PFAM
Pfam:FAD_binding_3 4 55 1.5e-7 PFAM
Pfam:FAD_binding_2 6 46 8e-9 PFAM
Pfam:Pyr_redox 6 53 3.2e-7 PFAM
Pfam:FAD_oxidored 6 83 1.1e-8 PFAM
Pfam:DAO 6 101 3.9e-8 PFAM
Pfam:Pyr_redox_2 6 102 6.5e-7 PFAM
Pfam:NAD_binding_8 9 75 3.6e-17 PFAM
Pfam:Amino_oxidase 14 90 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168613
SMART Domains Protein: ENSMUSP00000127235
Gene: ENSMUSG00000040147

DomainStartEndE-ValueType
Pfam:Thi4 2 46 8.7e-6 PFAM
Pfam:FAD_binding_3 4 52 1.9e-5 PFAM
Pfam:FAD_binding_2 6 46 6.4e-7 PFAM
Pfam:Pyr_redox 6 52 2e-5 PFAM
Pfam:DAO 6 81 4.2e-6 PFAM
Pfam:NAD_binding_8 9 75 3.9e-15 PFAM
Pfam:Amino_oxidase 14 162 2.8e-18 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the flavin monoamine oxidase family. It is a enzyme located in the mitochondrial outer membrane. It catalyzes the oxidative deamination of biogenic and xenobiotic amines and plays an important role in the metabolism of neuroactive and vasoactive amines in the central nervous sysytem and peripheral tissues. This protein preferentially degrades benzylamine and phenylethylamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased brain levels and urinary excretion of beta-phenylethylamine, stress-induced hyperactivity, and decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,315,995 V622A possibly damaging Het
Ankef1 A G 2: 136,552,441 N590S probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano3 A T 2: 110,661,480 N867K possibly damaging Het
Ash1l T C 3: 89,066,275 V2547A probably damaging Het
Ccpg1os T A 9: 72,979,893 R111* probably null Het
Chil5 A T 3: 106,017,978 V209E possibly damaging Het
Cltc A T 11: 86,722,321 C459S probably damaging Het
Col6a4 T A 9: 106,066,960 D1105V possibly damaging Het
Cyp2c66 A G 19: 39,163,438 D199G probably benign Het
Cyp4f18 A G 8: 71,989,058 probably null Het
Cysrt1 A T 2: 25,239,351 C50S possibly damaging Het
Dapk1 A G 13: 60,721,778 K278R probably benign Het
Eefsec C A 6: 88,281,575 S512I probably damaging Het
Emilin1 T C 5: 30,920,620 F908L possibly damaging Het
Eml1 T C 12: 108,537,337 V731A possibly damaging Het
Erc2 T C 14: 27,652,872 S16P probably benign Het
Gfpt2 A G 11: 49,823,799 R342G probably damaging Het
Gpr142 A T 11: 114,804,317 Q36L probably benign Het
Grik5 A G 7: 25,015,527 S681P probably damaging Het
Hecw1 A T 13: 14,346,029 S208T possibly damaging Het
Hmgcr G A 13: 96,656,732 A464V probably benign Het
Igkv2-109 A G 6: 68,303,085 T97A possibly damaging Het
Ino80 G T 2: 119,431,945 Q687K probably damaging Het
Kdm4d T C 9: 14,464,113 N150D probably damaging Het
Klf4 A G 4: 55,530,481 I210T possibly damaging Het
Klkb1 C A 8: 45,270,697 Q560H probably benign Het
Lce1a2 A T 3: 92,669,135 V40E unknown Het
Mipol1 C T 12: 57,496,499 T393I probably benign Het
Mst1 A G 9: 108,082,247 D244G probably damaging Het
Nexn G A 3: 152,243,888 R258C probably damaging Het
Olfr1353 A G 10: 78,970,203 I185V probably benign Het
Olfr748 A C 14: 50,710,914 I195L probably benign Het
Olfr777 A G 10: 129,268,666 I219T probably damaging Het
Olfr975 T C 9: 39,949,925 N282S probably damaging Het
Optc T C 1: 133,900,977 probably benign Het
Pabpc2 C A 18: 39,775,383 P567Q probably benign Het
Ppm1j A G 3: 104,784,674 H324R possibly damaging Het
Reg3g A T 6: 78,466,561 probably null Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Ski T C 4: 155,159,392 T554A probably benign Het
Slfn5 G A 11: 82,961,696 V883M probably benign Het
Stradb T C 1: 58,991,174 probably benign Het
Tex19.1 A G 11: 121,147,799 T328A probably benign Het
Tpsab1 T C 17: 25,345,399 N27S possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A T 2: 76,812,900 L13225Q probably damaging Het
Vmn1r28 A G 6: 58,265,858 T229A probably benign Het
Wapl A G 14: 34,724,754 K600E probably damaging Het
Zfp217 T C 2: 170,114,058 probably null Het
Other mutations in Maob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Maob APN X 16712642 missense probably damaging 1.00
IGL01411:Maob APN X 16712569 missense possibly damaging 0.94
R0616:Maob UTSW X 16710163 missense possibly damaging 0.76
R4711:Maob UTSW X 16716423 missense probably benign
R4832:Maob UTSW X 16716423 missense probably benign
R5112:Maob UTSW X 16716423 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTATGTGGAGCTTGGC -3'
(R):5'- TTCAGAAGCATAGTCAACCCTC -3'

Sequencing Primer
(F):5'- AGCTTGGCTTCAATTGCAGG -3'
(R):5'- GCACTACCCTGTAAATTCTGAGAG -3'
Posted On2016-06-15