Incidental Mutation 'R0446:B3galt4'
ID39410
Institutional Source Beutler Lab
Gene Symbol B3galt4
Ensembl Gene ENSMUSG00000067370
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
SynonymsGal-T2
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33949909-33951477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33951018 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000084823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000173196] [ENSMUST00000174609]
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025178
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087543
AA Change: E82G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370
AA Change: E82G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect probably benign
Transcript: ENSMUST00000173196
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Emx2 A T 19: 59,463,916 K211* probably null Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in B3galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:B3galt4 APN 17 33951213 missense probably benign 0.23
IGL02216:B3galt4 APN 17 33950565 missense probably damaging 1.00
R0326:B3galt4 UTSW 17 33950748 missense probably damaging 1.00
R0419:B3galt4 UTSW 17 33950790 missense probably damaging 1.00
R1024:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1028:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1412:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1590:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1591:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1681:B3galt4 UTSW 17 33951213 missense probably benign 0.23
R1851:B3galt4 UTSW 17 33950911 missense probably benign 0.26
R1955:B3galt4 UTSW 17 33950632 nonsense probably null
R2103:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R5802:B3galt4 UTSW 17 33950757 missense probably damaging 1.00
R6922:B3galt4 UTSW 17 33950847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATCCCTGTGTGCTGCTGACTC -3'
(R):5'- AGAACAGCATCTGTGATGCGCC -3'

Sequencing Primer
(F):5'- TGCTGCTGACTCTGAGGAC -3'
(R):5'- AGCTGGTTAAAGCCGTCCTC -3'
Posted On2013-05-23