Incidental Mutation 'R5116:Olfr603'
ID394193
Institutional Source Beutler Lab
Gene Symbol Olfr603
Ensembl Gene ENSMUSG00000059874
Gene Nameolfactory receptor 603
SynonymsMOR32-2, GA_x6K02T2PBJ9-6092550-6092362, MOR32-14_i, GA_x6K02T2PBJ9-6096387-6095449, Olfr604
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5116 (G1)
Quality Score174
Status Validated
Chromosome7
Chromosomal Location103383062-103386177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103383864 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 46 (T46I)
Ref Sequence ENSEMBL: ENSMUSP00000151321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071844] [ENSMUST00000218246]
Predicted Effect probably benign
Transcript: ENSMUST00000071844
AA Change: T46I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071744
Gene: ENSMUSG00000059874
AA Change: T46I

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.7e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 210 1.9e-10 PFAM
Pfam:7tm_1 43 293 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218246
AA Change: T46I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Olfr603
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Olfr603 APN 7 103383465 missense probably damaging 0.98
IGL01582:Olfr603 APN 7 103383599 nonsense probably null
IGL01788:Olfr603 APN 7 103383563 missense probably benign 0.00
IGL02837:Olfr603 UTSW 7 103383615 missense probably damaging 1.00
R1807:Olfr603 UTSW 7 103383583 missense probably benign 0.25
R2097:Olfr603 UTSW 7 103383633 missense probably damaging 1.00
R2161:Olfr603 UTSW 7 103383200 missense probably benign 0.01
R4870:Olfr603 UTSW 7 103383633 missense probably damaging 1.00
R6263:Olfr603 UTSW 7 103383196 missense possibly damaging 0.88
R6385:Olfr603 UTSW 7 103383897 missense possibly damaging 0.61
R6980:Olfr603 UTSW 7 103383096 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAATTGCCATGGCCAGGAG -3'
(R):5'- ATTGCAGATAGTCCTCCAGGAG -3'

Sequencing Primer
(F):5'- GAGTACAACAGATTCCATGCCTGTG -3'
(R):5'- ATAGTCCTCCAGGAGTCTGAG -3'
Posted On2016-06-15