Incidental Mutation 'R5116:Cckbr'
ID394194
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105433655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 75 (I75N)
Ref Sequence ENSEMBL: ENSMUSP00000138052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably damaging
Transcript: ENSMUST00000033189
AA Change: I75N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898
AA Change: I75N

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181339
AA Change: I75N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898
AA Change: I75N

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5589:Cckbr UTSW 7 105434525 missense probably damaging 0.98
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTAGTCCAGGGATGTTAGAG -3'
(R):5'- TGTCTCACCTACCCATGAGG -3'

Sequencing Primer
(F):5'- TCCAGGGATGTTAGAGAGCATTC -3'
(R):5'- GGTAGGAAACGGCCTTGC -3'
Posted On2016-06-15