Incidental Mutation 'R5116:Nlrc5'
ID394197
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94481860 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 778 (L778P)
Ref Sequence ENSEMBL: ENSMUSP00000148677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
Predicted Effect probably damaging
Transcript: ENSMUST00000053085
AA Change: L778P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: L778P

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182409
AA Change: L778P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000183132
Predicted Effect probably damaging
Transcript: ENSMUST00000211816
AA Change: L778P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGCACATTGTACACCTAAGCCC -3'
(R):5'- TGCAGCTTCCTGACAGTAGG -3'

Sequencing Primer
(F):5'- ATTGTACACCTAAGCCCTGGGAG -3'
(R):5'- GGACATGTGATAGCCACTTTCAC -3'
Posted On2016-06-15