Incidental Mutation 'R5116:Ccdc151'
ID394200
Institutional Source Beutler Lab
Gene Symbol Ccdc151
Ensembl Gene ENSMUSG00000039632
Gene Namecoiled-coil domain containing 151
Synonyms
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21989871-22002634 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 21990128 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 595 (*595Q)
Ref Sequence ENSEMBL: ENSMUSP00000110993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044926] [ENSMUST00000045726] [ENSMUST00000115336] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably null
Transcript: ENSMUST00000044926
AA Change: *594Q
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632
AA Change: *594Q

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115336
AA Change: *595Q
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632
AA Change: *595Q

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mico homozygous for an ENU-induced allele exhibit dextrocardia associated with situs inversus totalis and hypoplastic spleen, adrenal anomalies and immotile/dyskinetic tracheal airway cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Ccdc151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ccdc151 APN 9 21995379 critical splice acceptor site probably null
IGL01922:Ccdc151 APN 9 21993530 unclassified probably benign
IGL02223:Ccdc151 APN 9 21993612 missense probably damaging 1.00
IGL03161:Ccdc151 APN 9 22002315 missense probably benign 0.02
IGL03269:Ccdc151 APN 9 21998043 critical splice donor site probably null
R0118:Ccdc151 UTSW 9 21995057 missense probably benign 0.03
R0129:Ccdc151 UTSW 9 21993552 missense probably damaging 0.98
R0279:Ccdc151 UTSW 9 21990247 unclassified probably benign
R0390:Ccdc151 UTSW 9 21991708 missense probably benign 0.00
R1349:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1372:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1891:Ccdc151 UTSW 9 21995381 splice site probably null
R2044:Ccdc151 UTSW 9 21991858 missense possibly damaging 0.95
R5147:Ccdc151 UTSW 9 21994862 missense probably benign 0.21
R5929:Ccdc151 UTSW 9 22002422 missense possibly damaging 0.50
R6182:Ccdc151 UTSW 9 21990402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGTGGGAACTTCTGGCTC -3'
(R):5'- CGAGGTGGCCTTAAGTCAAG -3'

Sequencing Primer
(F):5'- GGCTCGGCCTTTTCTCTC -3'
(R):5'- CTTAAGTCAAGGCCAAGGAGG -3'
Posted On2016-06-15